summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
Diffstat (limited to 'sci-biology')
-rw-r--r--sci-biology/ApE/ApE-2.0.7-r1.ebuild54
-rw-r--r--sci-biology/ApE/Manifest1
-rw-r--r--sci-biology/ApE/metadata.xml10
-rw-r--r--sci-biology/GBrowse/GBrowse-2.48-r1.ebuild72
-rw-r--r--sci-biology/GBrowse/Manifest1
-rw-r--r--sci-biology/GBrowse/files/GBrowseInstall.pm-2.39.patch72
-rw-r--r--sci-biology/GBrowse/metadata.xml8
-rw-r--r--sci-biology/aaindex/Manifest1
-rw-r--r--sci-biology/aaindex/aaindex-9.1.ebuild41
-rw-r--r--sci-biology/aaindex/metadata.xml22
-rw-r--r--sci-biology/abyss/Manifest3
-rw-r--r--sci-biology/abyss/abyss-1.3.3.ebuild41
-rw-r--r--sci-biology/abyss/abyss-1.3.4.ebuild46
-rw-r--r--sci-biology/abyss/abyss-1.3.6.ebuild47
-rw-r--r--sci-biology/abyss/files/abyss-1.3.3-ac_prog_ar.patch18
-rw-r--r--sci-biology/abyss/files/abyss-1.3.3-gcc-4.7.patch15
-rw-r--r--sci-biology/abyss/files/abyss-1.3.4-gcc-4.7.patch15
-rw-r--r--sci-biology/abyss/files/abyss-1.3.6-ac_prog_ar.patch18
-rw-r--r--sci-biology/abyss/files/abyss-1.3.6-gcc-4.7.patch15
-rw-r--r--sci-biology/abyss/metadata.xml5
-rw-r--r--sci-biology/allpathslg/Manifest3
-rw-r--r--sci-biology/allpathslg/allpathslg-42337.ebuild35
-rw-r--r--sci-biology/allpathslg/allpathslg-47093.ebuild36
-rw-r--r--sci-biology/allpathslg/allpathslg-52415.ebuild54
-rw-r--r--sci-biology/allpathslg/files/allpathslg-47093-gcc4.9.patch16
-rw-r--r--sci-biology/allpathslg/metadata.xml5
-rw-r--r--sci-biology/amap/Manifest1
-rw-r--r--sci-biology/amap/amap-2.2-r2.ebuild50
-rw-r--r--sci-biology/amap/files/amap-2.2-includes.patch44
-rw-r--r--sci-biology/amap/files/amap-2.2-makefile.patch35
-rw-r--r--sci-biology/amap/metadata.xml5
-rw-r--r--sci-biology/amos/Manifest1
-rw-r--r--sci-biology/amos/amos-3.1.0-r1.ebuild37
-rw-r--r--sci-biology/amos/amos-3.1.0.ebuild29
-rw-r--r--sci-biology/amos/files/amos-3.1.0-gcc-4.7.patch15
-rw-r--r--sci-biology/amos/files/amos-3.1.0-goBambus2.py-indent-and-cleanup.patch25
-rw-r--r--sci-biology/amos/metadata.xml8
-rw-r--r--sci-biology/arb/Manifest7
-rw-r--r--sci-biology/arb/arb-5.1-r1.ebuild78
-rw-r--r--sci-biology/arb/arb-5.2.ebuild80
-rw-r--r--sci-biology/arb/arb-5.3.ebuild78
-rw-r--r--sci-biology/arb/files/5.1-bfr-overflow.patch16
-rw-r--r--sci-biology/arb/files/5.1-libs.patch16
-rw-r--r--sci-biology/arb/files/5.2-libpng15.patch45
-rw-r--r--sci-biology/arb/files/arb-5.2-gcc-47.patch15
-rw-r--r--sci-biology/arb/metadata.xml5
-rw-r--r--sci-biology/ariadne/Manifest1
-rw-r--r--sci-biology/ariadne/ariadne-1.3-r1.ebuild38
-rw-r--r--sci-biology/ariadne/ariadne-1.3-r2.ebuild40
-rw-r--r--sci-biology/ariadne/files/ariadne-1.3-gcc4.patch10
-rw-r--r--sci-biology/ariadne/files/ariadne-1.3-implicits.patch23
-rw-r--r--sci-biology/ariadne/metadata.xml17
-rw-r--r--sci-biology/augustus/Manifest1
-rw-r--r--sci-biology/augustus/augustus-2.5.5.ebuild50
-rw-r--r--sci-biology/augustus/files/augustus-2.5.5-sane-build.patch156
-rw-r--r--sci-biology/augustus/metadata.xml5
-rw-r--r--sci-biology/bamtools/Manifest2
-rw-r--r--sci-biology/bamtools/bamtools-1.0.2.ebuild33
-rw-r--r--sci-biology/bamtools/bamtools-2.3.0.ebuild28
-rw-r--r--sci-biology/bamtools/files/bamtools-2.2.3-unbundle.patch32
-rw-r--r--sci-biology/bamtools/files/bamtools-2.3.0-unbundle.patch23
-rw-r--r--sci-biology/bamtools/metadata.xml14
-rw-r--r--sci-biology/beast-mcmc/Manifest2
-rw-r--r--sci-biology/beast-mcmc/beast-mcmc-1.5.2.ebuild82
-rw-r--r--sci-biology/beast-mcmc/beast-mcmc-1.7.5.ebuild86
-rw-r--r--sci-biology/beast-mcmc/beast-mcmc-9999.ebuild81
-rw-r--r--sci-biology/beast-mcmc/metadata.xml5
-rw-r--r--sci-biology/bedtools/Manifest2
-rw-r--r--sci-biology/bedtools/bedtools-2.16.2.ebuild33
-rw-r--r--sci-biology/bedtools/bedtools-2.20.1.ebuild33
-rw-r--r--sci-biology/bedtools/metadata.xml17
-rw-r--r--sci-biology/bfast/Manifest1
-rw-r--r--sci-biology/bfast/bfast-0.7.0a.ebuild40
-rw-r--r--sci-biology/bfast/metadata.xml8
-rw-r--r--sci-biology/biogrep/Manifest1
-rw-r--r--sci-biology/biogrep/biogrep-1.0-r1.ebuild25
-rw-r--r--sci-biology/biogrep/biogrep-1.0.ebuild18
-rw-r--r--sci-biology/biogrep/metadata.xml9
-rw-r--r--sci-biology/biojava/Manifest2
-rw-r--r--sci-biology/biojava/biojava-1.6.ebuild73
-rw-r--r--sci-biology/biojava/biojava-1.7.ebuild73
-rw-r--r--sci-biology/biojava/metadata.xml6
-rw-r--r--sci-biology/bioperl-db/Manifest1
-rw-r--r--sci-biology/bioperl-db/bioperl-db-1.6.9.ebuild34
-rw-r--r--sci-biology/bioperl-db/bioperl-db-9999-r1.ebuild39
-rw-r--r--sci-biology/bioperl-db/metadata.xml8
-rw-r--r--sci-biology/bioperl-network/Manifest1
-rw-r--r--sci-biology/bioperl-network/bioperl-network-1.6.9.ebuild31
-rw-r--r--sci-biology/bioperl-network/bioperl-network-9999-r1.ebuild32
-rw-r--r--sci-biology/bioperl-network/metadata.xml8
-rw-r--r--sci-biology/bioperl-run/Manifest1
-rw-r--r--sci-biology/bioperl-run/bioperl-run-1.6.9.ebuild42
-rw-r--r--sci-biology/bioperl-run/bioperl-run-9999-r1.ebuild42
-rw-r--r--sci-biology/bioperl-run/files/bioperl-run-Pise-test-patch.diff22
-rw-r--r--sci-biology/bioperl-run/metadata.xml8
-rw-r--r--sci-biology/bioperl/Manifest1
-rw-r--r--sci-biology/bioperl/bioperl-1.6.9.ebuild68
-rw-r--r--sci-biology/bioperl/bioperl-9999-r1.ebuild75
-rw-r--r--sci-biology/bioperl/metadata.xml13
-rw-r--r--sci-biology/biopython/Manifest1
-rw-r--r--sci-biology/biopython/biopython-1.65.ebuild56
-rw-r--r--sci-biology/biopython/files/biopython-1.65-test-fix-backport.patch40
-rw-r--r--sci-biology/biopython/metadata.xml5
-rw-r--r--sci-biology/bioruby/Manifest1
-rw-r--r--sci-biology/bioruby/bioruby-1.4.3.0001-r1.ebuild38
-rw-r--r--sci-biology/bioruby/bioruby-9999.ebuild41
-rw-r--r--sci-biology/bioruby/files/bioruby-1.4.3.0001-fix-tests.patch29
-rw-r--r--sci-biology/bioruby/metadata.xml5
-rw-r--r--sci-biology/biosql/Manifest1
-rw-r--r--sci-biology/biosql/biosql-1.0.1.ebuild33
-rw-r--r--sci-biology/biosql/metadata.xml5
-rw-r--r--sci-biology/blat/Manifest1
-rw-r--r--sci-biology/blat/blat-34-r1.ebuild45
-rw-r--r--sci-biology/blat/blat-34.ebuild34
-rw-r--r--sci-biology/blat/files/34-gentoo.patch226
-rw-r--r--sci-biology/blat/metadata.xml5
-rw-r--r--sci-biology/blossoc/Manifest1
-rw-r--r--sci-biology/blossoc/blossoc-1.4.0.ebuild31
-rw-r--r--sci-biology/blossoc/files/blossoc-1.4.0-gcc43.patch15
-rw-r--r--sci-biology/blossoc/metadata.xml5
-rw-r--r--sci-biology/bowtie/Manifest2
-rw-r--r--sci-biology/bowtie/bowtie-0.12.8.ebuild44
-rw-r--r--sci-biology/bowtie/bowtie-1.0.0.ebuild42
-rw-r--r--sci-biology/bowtie/files/bowtie-0.12.8-gcc-47.patch45
-rw-r--r--sci-biology/bowtie/metadata.xml8
-rw-r--r--sci-biology/bwa/Manifest1
-rw-r--r--sci-biology/bwa/bwa-0.7.12.ebuild34
-rw-r--r--sci-biology/bwa/files/bwa-0.7.12-Makefile.patch27
-rw-r--r--sci-biology/bwa/metadata.xml8
-rw-r--r--sci-biology/cd-hit/Manifest3
-rw-r--r--sci-biology/cd-hit/cd-hit-4.5.1.ebuild42
-rw-r--r--sci-biology/cd-hit/cd-hit-4.5.4.ebuild43
-rw-r--r--sci-biology/cd-hit/cd-hit-4.6.ebuild44
-rw-r--r--sci-biology/cd-hit/files/4.5.1-gentoo.patch85
-rw-r--r--sci-biology/cd-hit/files/4.5.4-gentoo.patch98
-rw-r--r--sci-biology/cd-hit/files/4.6-gentoo.patch117
-rw-r--r--sci-biology/cd-hit/metadata.xml23
-rw-r--r--sci-biology/clustal-omega/Manifest2
-rw-r--r--sci-biology/clustal-omega/clustal-omega-1.2.0.ebuild38
-rw-r--r--sci-biology/clustal-omega/clustal-omega-1.2.1.ebuild38
-rw-r--r--sci-biology/clustal-omega/metadata.xml5
-rw-r--r--sci-biology/clustalw-mpi/Manifest1
-rw-r--r--sci-biology/clustalw-mpi/clustalw-mpi-0.13-r1.ebuild36
-rw-r--r--sci-biology/clustalw-mpi/files/0.13-gentoo.patch23
-rw-r--r--sci-biology/clustalw-mpi/metadata.xml11
-rw-r--r--sci-biology/clustalw/Manifest2
-rw-r--r--sci-biology/clustalw/clustalw-1.83-r3.ebuild36
-rw-r--r--sci-biology/clustalw/clustalw-2.1.ebuild14
-rw-r--r--sci-biology/clustalw/files/1.83-as-needed.patch17
-rw-r--r--sci-biology/clustalw/metadata.xml5
-rw-r--r--sci-biology/clustalx/Manifest1
-rw-r--r--sci-biology/clustalx/clustalx-2.1-r1.ebuild43
-rw-r--r--sci-biology/clustalx/metadata.xml5
-rw-r--r--sci-biology/consed/Manifest4
-rw-r--r--sci-biology/consed/consed-19-r2.ebuild71
-rw-r--r--sci-biology/consed/consed-27.ebuild90
-rw-r--r--sci-biology/consed/metadata.xml5
-rw-r--r--sci-biology/cufflinks/Manifest2
-rw-r--r--sci-biology/cufflinks/cufflinks-1.3.0-r1.ebuild40
-rw-r--r--sci-biology/cufflinks/cufflinks-2.2.1-r1.ebuild52
-rw-r--r--sci-biology/cufflinks/cufflinks-2.2.1.ebuild40
-rw-r--r--sci-biology/cufflinks/files/cufflinks-1.3.0-autotools.patch38
-rw-r--r--sci-biology/cufflinks/files/cufflinks-1.3.0-boost.patch1320
-rw-r--r--sci-biology/cufflinks/files/cufflinks-1.3.0-gcc-4.7.patch20
-rw-r--r--sci-biology/cufflinks/files/cufflinks-2.2.1-flags.patch28
-rw-r--r--sci-biology/cufflinks/files/cufflinks-2.2.1-hts.patch16
-rw-r--r--sci-biology/cufflinks/metadata.xml5
-rw-r--r--sci-biology/cutg/Manifest1
-rw-r--r--sci-biology/cutg/cutg-160-r1.ebuild50
-rw-r--r--sci-biology/cutg/metadata.xml12
-rw-r--r--sci-biology/dialign-tx/Manifest1
-rw-r--r--sci-biology/dialign-tx/dialign-tx-1.0.2-r1.ebuild44
-rw-r--r--sci-biology/dialign-tx/files/dialign-tx-1.0.2-implicits.patch18
-rw-r--r--sci-biology/dialign-tx/metadata.xml5
-rw-r--r--sci-biology/dialign2/Manifest1
-rw-r--r--sci-biology/dialign2/dialign2-2.2.1.ebuild35
-rw-r--r--sci-biology/dialign2/metadata.xml8
-rw-r--r--sci-biology/diya/Manifest1
-rw-r--r--sci-biology/diya/diya-1.0_rc4.ebuild43
-rw-r--r--sci-biology/diya/metadata.xml8
-rw-r--r--sci-biology/elph/Manifest2
-rw-r--r--sci-biology/elph/elph-0.1.5.ebuild37
-rw-r--r--sci-biology/elph/elph-1.0.1.ebuild28
-rw-r--r--sci-biology/elph/files/elph-0.1.4-usage.patch133
-rw-r--r--sci-biology/elph/files/elph-0.1.5-usage.patch133
-rw-r--r--sci-biology/elph/metadata.xml12
-rw-r--r--sci-biology/embassy-cbstools/Manifest3
-rw-r--r--sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.650.ebuild15
-rw-r--r--sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.ebuild13
-rw-r--r--sci-biology/embassy-cbstools/files/embassy-cbstools-1.0.0.650_fix-build-system.patch110
-rw-r--r--sci-biology/embassy-cbstools/metadata.xml5
-rw-r--r--sci-biology/embassy-clustalomega/Manifest1
-rw-r--r--sci-biology/embassy-clustalomega/embassy-clustalomega-1.1.0.ebuild17
-rw-r--r--sci-biology/embassy-clustalomega/files/embassy-clustalomega-1.1.0_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-clustalomega/metadata.xml5
-rw-r--r--sci-biology/embassy-domainatrix/Manifest3
-rw-r--r--sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.0-r3.ebuild13
-rw-r--r--sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.650.ebuild15
-rw-r--r--sci-biology/embassy-domainatrix/files/embassy-domainatrix-0.1.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-domainatrix/metadata.xml5
-rw-r--r--sci-biology/embassy-domalign/Manifest3
-rw-r--r--sci-biology/embassy-domalign/embassy-domalign-0.1.0-r3.ebuild13
-rw-r--r--sci-biology/embassy-domalign/embassy-domalign-0.1.650.ebuild15
-rw-r--r--sci-biology/embassy-domalign/files/embassy-domalign-0.1.650_fix-build-system.patch101
-rw-r--r--sci-biology/embassy-domalign/metadata.xml5
-rw-r--r--sci-biology/embassy-domsearch/Manifest3
-rw-r--r--sci-biology/embassy-domsearch/embassy-domsearch-0.1.0-r3.ebuild13
-rw-r--r--sci-biology/embassy-domsearch/embassy-domsearch-0.1.650.ebuild15
-rw-r--r--sci-biology/embassy-domsearch/files/embassy-domsearch-0.1.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-domsearch/metadata.xml5
-rw-r--r--sci-biology/embassy-emnu/Manifest3
-rw-r--r--sci-biology/embassy-emnu/embassy-emnu-1.05-r5.ebuild19
-rw-r--r--sci-biology/embassy-emnu/embassy-emnu-1.05.650.ebuild19
-rw-r--r--sci-biology/embassy-emnu/files/embassy-emnu-1.05.650_fix-build-system.patch139
-rw-r--r--sci-biology/embassy-emnu/metadata.xml5
-rw-r--r--sci-biology/embassy-esim4/Manifest3
-rw-r--r--sci-biology/embassy-esim4/embassy-esim4-1.0.0-r5.ebuild13
-rw-r--r--sci-biology/embassy-esim4/embassy-esim4-1.0.0.650.ebuild15
-rw-r--r--sci-biology/embassy-esim4/files/embassy-esim4-1.0.0.650_fix-build-system.patch110
-rw-r--r--sci-biology/embassy-esim4/metadata.xml5
-rw-r--r--sci-biology/embassy-hmmer/Manifest3
-rw-r--r--sci-biology/embassy-hmmer/embassy-hmmer-2.3.2-r2.ebuild21
-rw-r--r--sci-biology/embassy-hmmer/embassy-hmmer-2.3.2.650.ebuild17
-rw-r--r--sci-biology/embassy-hmmer/files/embassy-hmmer-2.3.2.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-hmmer/metadata.xml5
-rw-r--r--sci-biology/embassy-iprscan/Manifest3
-rw-r--r--sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.650.ebuild15
-rw-r--r--sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.ebuild13
-rw-r--r--sci-biology/embassy-iprscan/files/embassy-iprscan-4.3.1.650_fix-build-system.patch110
-rw-r--r--sci-biology/embassy-iprscan/metadata.xml5
-rw-r--r--sci-biology/embassy-meme/Manifest1
-rw-r--r--sci-biology/embassy-meme/embassy-meme-4.7.650.ebuild17
-rw-r--r--sci-biology/embassy-meme/files/embassy-meme-4.7.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-meme/metadata.xml5
-rw-r--r--sci-biology/embassy-memenew/Manifest2
-rw-r--r--sci-biology/embassy-memenew/embassy-memenew-0.1.0-r1.ebuild19
-rw-r--r--sci-biology/embassy-memenew/metadata.xml5
-rw-r--r--sci-biology/embassy-mira/Manifest2
-rw-r--r--sci-biology/embassy-mira/embassy-mira-2.8.2.ebuild13
-rw-r--r--sci-biology/embassy-mira/metadata.xml5
-rw-r--r--sci-biology/embassy-mse/Manifest3
-rw-r--r--sci-biology/embassy-mse/embassy-mse-1.0.0-r6.ebuild19
-rw-r--r--sci-biology/embassy-mse/embassy-mse-3.0.0.650.ebuild25
-rw-r--r--sci-biology/embassy-mse/files/embassy-mse-3.0.0.650_fix-build-system.patch149
-rw-r--r--sci-biology/embassy-mse/metadata.xml5
-rw-r--r--sci-biology/embassy-phylipnew/Manifest3
-rw-r--r--sci-biology/embassy-phylipnew/embassy-phylipnew-3.67.ebuild14
-rw-r--r--sci-biology/embassy-phylipnew/embassy-phylipnew-3.69.650.ebuild17
-rw-r--r--sci-biology/embassy-phylipnew/files/embassy-phylipnew-3.69.650_fix-build-system.patch111
-rw-r--r--sci-biology/embassy-phylipnew/metadata.xml5
-rw-r--r--sci-biology/embassy-signature/Manifest3
-rw-r--r--sci-biology/embassy-signature/embassy-signature-0.1.0-r3.ebuild13
-rw-r--r--sci-biology/embassy-signature/embassy-signature-0.1.650.ebuild13
-rw-r--r--sci-biology/embassy-signature/files/embassy-signature-0.1.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-signature/metadata.xml5
-rw-r--r--sci-biology/embassy-structure/Manifest3
-rw-r--r--sci-biology/embassy-structure/embassy-structure-0.1.0-r3.ebuild13
-rw-r--r--sci-biology/embassy-structure/embassy-structure-0.1.650.ebuild15
-rw-r--r--sci-biology/embassy-structure/files/embassy-structure-0.1.650_fix-build-system.patch100
-rw-r--r--sci-biology/embassy-structure/metadata.xml5
-rw-r--r--sci-biology/embassy-topo/Manifest3
-rw-r--r--sci-biology/embassy-topo/embassy-topo-1.0.0-r5.ebuild13
-rw-r--r--sci-biology/embassy-topo/embassy-topo-2.0.650.ebuild15
-rw-r--r--sci-biology/embassy-topo/files/embassy-topo-2.0.650_fix-build-system.patch110
-rw-r--r--sci-biology/embassy-topo/metadata.xml5
-rw-r--r--sci-biology/embassy-vienna/Manifest3
-rw-r--r--sci-biology/embassy-vienna/embassy-vienna-1.7.2.650.ebuild15
-rw-r--r--sci-biology/embassy-vienna/embassy-vienna-1.7.2.ebuild13
-rw-r--r--sci-biology/embassy-vienna/files/embassy-vienna-1.7.2.650_fix-build-system.patch108
-rw-r--r--sci-biology/embassy-vienna/metadata.xml5
-rw-r--r--sci-biology/embassy/embassy-6.0.1.ebuild33
-rw-r--r--sci-biology/embassy/embassy-6.6.0.ebuild31
-rw-r--r--sci-biology/embassy/metadata.xml5
-rw-r--r--sci-biology/emboss/Manifest4
-rw-r--r--sci-biology/emboss/emboss-6.0.1.ebuild112
-rw-r--r--sci-biology/emboss/emboss-6.3.1_p4-r1.ebuild117
-rw-r--r--sci-biology/emboss/emboss-6.6.0.ebuild61
-rw-r--r--sci-biology/emboss/files/22emboss4
-rw-r--r--sci-biology/emboss/files/6.3.1_p4-unbundle-libs.patch600
-rw-r--r--sci-biology/emboss/files/README.Gentoo28
-rw-r--r--sci-biology/emboss/files/README.gentoo34
-rw-r--r--sci-biology/emboss/files/emboss-5.0.0-as-needed.patch24
-rw-r--r--sci-biology/emboss/files/emboss-6.3.1_p4-r1_plcol.patch112
-rw-r--r--sci-biology/emboss/files/emboss-6.6.0_FORTIFY_SOURCE-fix.patch11
-rw-r--r--sci-biology/emboss/files/emboss-6.6.0_fix-build-system.patch411
-rw-r--r--sci-biology/emboss/files/emboss-6.6.0_plplot-declarations.patch61
-rw-r--r--sci-biology/emboss/files/emboss-6.6.0_qa-implicit-declarations.patch74
-rw-r--r--sci-biology/emboss/files/emboss-README.Gentoo-134
-rw-r--r--sci-biology/emboss/files/emboss-README.Gentoo-234
-rw-r--r--sci-biology/emboss/metadata.xml18
-rw-r--r--sci-biology/eugene/Manifest1
-rw-r--r--sci-biology/eugene/eugene-4.1.ebuild37
-rw-r--r--sci-biology/eugene/files/eugene-3.6-overflow.patch13
-rw-r--r--sci-biology/eugene/files/eugene-3.6-plugins.patch43
-rw-r--r--sci-biology/eugene/files/eugene-4.1-format-security.patch16
-rw-r--r--sci-biology/eugene/metadata.xml5
-rw-r--r--sci-biology/exonerate/Manifest1
-rw-r--r--sci-biology/exonerate/exonerate-2.2.0-r1.ebuild50
-rw-r--r--sci-biology/exonerate/files/exonerate-2.2.0-asneeded.patch15
-rw-r--r--sci-biology/exonerate/metadata.xml15
-rw-r--r--sci-biology/express/Manifest2
-rw-r--r--sci-biology/express/express-0.9.5-r1.ebuild36
-rw-r--r--sci-biology/express/express-0.9.5.ebuild35
-rw-r--r--sci-biology/express/express-1.5.1.ebuild37
-rw-r--r--sci-biology/express/files/express-1.5.1-buildsystem.patch55
-rw-r--r--sci-biology/express/metadata.xml5
-rw-r--r--sci-biology/fasta/Manifest2
-rw-r--r--sci-biology/fasta/fasta-35.4.10.ebuild58
-rw-r--r--sci-biology/fasta/fasta-36.3.5e.ebuild79
-rw-r--r--sci-biology/fasta/files/35.4.10-ldflags.patch26
-rw-r--r--sci-biology/fasta/files/fasta-36.3.5e-ldflags.patch74
-rw-r--r--sci-biology/fasta/metadata.xml11
-rw-r--r--sci-biology/fasttree/Manifest6
-rw-r--r--sci-biology/fasttree/fasttree-2.1.7.ebuild48
-rw-r--r--sci-biology/fasttree/fasttree-2.1.8.ebuild48
-rw-r--r--sci-biology/fasttree/files/CMakeLists.txt30
-rw-r--r--sci-biology/fasttree/files/fasttree-2.1.7-format-security.patch25
-rw-r--r--sci-biology/fasttree/files/fasttree-2.1.8-format-security.patch25
-rw-r--r--sci-biology/fasttree/metadata.xml11
-rw-r--r--sci-biology/finchtv/Manifest1
-rw-r--r--sci-biology/finchtv/finchtv-1.3.1-r2.ebuild30
-rw-r--r--sci-biology/finchtv/metadata.xml12
-rw-r--r--sci-biology/flower/Manifest1
-rw-r--r--sci-biology/flower/files/flower-0.7.2-ghc-7.8.patch27
-rw-r--r--sci-biology/flower/flower-0.7.2.ebuild35
-rw-r--r--sci-biology/flower/metadata.xml24
-rw-r--r--sci-biology/foldingathome/Manifest4
-rw-r--r--sci-biology/foldingathome/files/7.3/fah-init30
-rw-r--r--sci-biology/foldingathome/files/7.3/folding-conf.d10
-rw-r--r--sci-biology/foldingathome/files/7.3/initfolding5
-rw-r--r--sci-biology/foldingathome/foldingathome-7.3.6-r2.ebuild82
-rw-r--r--sci-biology/foldingathome/foldingathome-7.4.4.ebuild82
-rw-r--r--sci-biology/foldingathome/metadata.xml9
-rw-r--r--sci-biology/gatk/Manifest1
-rw-r--r--sci-biology/gatk/gatk-2.4.ebuild39
-rw-r--r--sci-biology/gatk/gatk-9999.ebuild41
-rw-r--r--sci-biology/gatk/metadata.xml5
-rw-r--r--sci-biology/gibbs/Manifest1
-rw-r--r--sci-biology/gibbs/files/gibbs-demo7
-rw-r--r--sci-biology/gibbs/gibbs-3.1.ebuild50
-rw-r--r--sci-biology/gibbs/metadata.xml10
-rw-r--r--sci-biology/glimmer/Manifest2
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02-glibc210.patch24
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02-jobserver-fix.patch22
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02-ldflags.patch88
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02b-jobserver-fix.patch22
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02b-ldflags.patch88
-rw-r--r--sci-biology/glimmer/files/glimmer-3.02b-rename_extract.patch196
-rw-r--r--sci-biology/glimmer/glimmer-3.02-r3.ebuild61
-rw-r--r--sci-biology/glimmer/glimmer-3.02b.ebuild68
-rw-r--r--sci-biology/glimmer/metadata.xml5
-rw-r--r--sci-biology/glimmerhmm/Manifest1
-rw-r--r--sci-biology/glimmerhmm/files/3.0.1-gentoo.patch153
-rw-r--r--sci-biology/glimmerhmm/glimmerhmm-3.0.1-r1.ebuild51
-rw-r--r--sci-biology/glimmerhmm/metadata.xml5
-rw-r--r--sci-biology/gmap/Manifest2
-rw-r--r--sci-biology/gmap/gmap-2011.10.07.ebuild36
-rw-r--r--sci-biology/gmap/gmap-2012.07.20.ebuild36
-rw-r--r--sci-biology/gmap/metadata.xml9
-rw-r--r--sci-biology/goby-cpp/Manifest3
-rw-r--r--sci-biology/goby-cpp/files/Alignments.proto597
-rw-r--r--sci-biology/goby-cpp/files/Reads.proto96
-rw-r--r--sci-biology/goby-cpp/files/goby-cpp-2.0.1-underlinking.patch16
-rw-r--r--sci-biology/goby-cpp/goby-cpp-1.9.7.3.ebuild26
-rw-r--r--sci-biology/goby-cpp/goby-cpp-1.9.8.1.ebuild26
-rw-r--r--sci-biology/goby-cpp/goby-cpp-2.0.1.ebuild42
-rw-r--r--sci-biology/goby-cpp/metadata.xml5
-rw-r--r--sci-biology/goby/Manifest4
-rw-r--r--sci-biology/goby/goby-1.9.7.3.ebuild57
-rw-r--r--sci-biology/goby/goby-1.9.8.1.ebuild57
-rw-r--r--sci-biology/goby/metadata.xml8
-rw-r--r--sci-biology/hmmer/Manifest2
-rw-r--r--sci-biology/hmmer/files/hmmer-3.0-fix_tests.patch23
-rw-r--r--sci-biology/hmmer/files/hmmer-3.0-perl-5.16-2.patch132
-rw-r--r--sci-biology/hmmer/hmmer-2.3.2-r1.ebuild51
-rw-r--r--sci-biology/hmmer/hmmer-2.3.2-r2.ebuild51
-rw-r--r--sci-biology/hmmer/hmmer-3.0.ebuild45
-rw-r--r--sci-biology/hmmer/metadata.xml9
-rw-r--r--sci-biology/iedera/Manifest1
-rw-r--r--sci-biology/iedera/iedera-1.04.ebuild22
-rw-r--r--sci-biology/iedera/metadata.xml5
-rw-r--r--sci-biology/infernal/Manifest1
-rw-r--r--sci-biology/infernal/files/infernal-1.0.2-ldflags.patch15
-rw-r--r--sci-biology/infernal/files/infernal-1.0.2-overflows.patch15
-rw-r--r--sci-biology/infernal/files/infernal-1.0.2-parallel-build.patch31
-rw-r--r--sci-biology/infernal/files/infernal-1.0.2-perl-5.16-2.patch147
-rw-r--r--sci-biology/infernal/infernal-1.0.2-r1.ebuild47
-rw-r--r--sci-biology/infernal/metadata.xml5
-rw-r--r--sci-biology/iqpnni/Manifest3
-rw-r--r--sci-biology/iqpnni/files/iqpnni-3.3.1-gcc4.3.patch13
-rw-r--r--sci-biology/iqpnni/iqpnni-3.2.ebuild26
-rw-r--r--sci-biology/iqpnni/iqpnni-3.3.1.ebuild34
-rw-r--r--sci-biology/iqpnni/iqpnni-3.3.2.ebuild28
-rw-r--r--sci-biology/iqpnni/metadata.xml5
-rw-r--r--sci-biology/kalign/Manifest1
-rw-r--r--sci-biology/kalign/kalign-2.03-r1.ebuild33
-rw-r--r--sci-biology/kalign/kalign-2.03.ebuild27
-rw-r--r--sci-biology/kalign/metadata.xml5
-rw-r--r--sci-biology/lagan/Manifest1
-rw-r--r--sci-biology/lagan/files/lagan-2.0-flags.patch107
-rw-r--r--sci-biology/lagan/files/lagan-2.0-gcc4.3.patch23
-rw-r--r--sci-biology/lagan/lagan-2.0-r1.ebuild50
-rw-r--r--sci-biology/lagan/lagan-2.0-r2.ebuild55
-rw-r--r--sci-biology/lagan/metadata.xml5
-rw-r--r--sci-biology/last/Manifest2
-rw-r--r--sci-biology/last/files/162-gcc46.patch15
-rw-r--r--sci-biology/last/files/162-ldflags.patch16
-rw-r--r--sci-biology/last/last-230.ebuild40
-rw-r--r--sci-biology/last/last-299.ebuild50
-rw-r--r--sci-biology/last/metadata.xml5
-rw-r--r--sci-biology/mafft/Manifest2
-rw-r--r--sci-biology/mafft/files/6.811-respect.patch192
-rw-r--r--sci-biology/mafft/files/mafft-7.037-respect.patch217
-rw-r--r--sci-biology/mafft/mafft-7.050.ebuild61
-rw-r--r--sci-biology/mafft/mafft-7.215.ebuild65
-rw-r--r--sci-biology/mafft/metadata.xml5
-rw-r--r--sci-biology/mammoth/Manifest1
-rw-r--r--sci-biology/mammoth/files/1.0-consistent-system-intrinsic.patch21
-rw-r--r--sci-biology/mammoth/mammoth-1.0-r1.ebuild43
-rw-r--r--sci-biology/mammoth/metadata.xml5
-rw-r--r--sci-biology/maq/Manifest2
-rw-r--r--sci-biology/maq/files/maq-0.7.1-bfr-overfl.patch16
-rw-r--r--sci-biology/maq/files/maq-0.7.1-flags.patch24
-rw-r--r--sci-biology/maq/files/maq-0.7.1-gcc-4.7.patch34
-rw-r--r--sci-biology/maq/maq-0.7.1-r1.ebuild40
-rw-r--r--sci-biology/maq/maq-0.7.1.ebuild24
-rw-r--r--sci-biology/maq/metadata.xml8
-rw-r--r--sci-biology/maqview/Manifest1
-rw-r--r--sci-biology/maqview/files/0.2.5-ldflags.patch46
-rw-r--r--sci-biology/maqview/files/0.2.5-zlib.patch33
-rw-r--r--sci-biology/maqview/files/maqview-0.2.5-gcc4.7.patch16
-rw-r--r--sci-biology/maqview/maqview-0.2.5-r2.ebuild32
-rw-r--r--sci-biology/maqview/metadata.xml8
-rw-r--r--sci-biology/mauve/mauve-9999.ebuild54
-rw-r--r--sci-biology/mauve/metadata.xml5
-rw-r--r--sci-biology/mauvealigner/mauvealigner-9999.ebuild35
-rw-r--r--sci-biology/mauvealigner/metadata.xml5
-rw-r--r--sci-biology/mcl/Manifest2
-rw-r--r--sci-biology/mcl/mcl-08.312.ebuild37
-rw-r--r--sci-biology/mcl/mcl-12.135.ebuild37
-rw-r--r--sci-biology/mcl/metadata.xml10
-rw-r--r--sci-biology/meme/Manifest1
-rw-r--r--sci-biology/meme/files/meme-3.5.4-Makefile.am.patch17
-rw-r--r--sci-biology/meme/files/meme-3.5.4-patch1.patch198
-rw-r--r--sci-biology/meme/files/meme-3.5.4-patch2.patch70
-rw-r--r--sci-biology/meme/files/meme-4.0.0-Makefile.am.patch17
-rw-r--r--sci-biology/meme/files/meme-4.8.1-Makefile.am.patch134
-rw-r--r--sci-biology/meme/meme-4.8.1-r2.ebuild85
-rw-r--r--sci-biology/meme/metadata.xml5
-rw-r--r--sci-biology/metadata.xml46
-rw-r--r--sci-biology/mira/Manifest2
-rw-r--r--sci-biology/mira/files/mira-3.0.0-asneeded.patch56
-rw-r--r--sci-biology/mira/files/mira-3.2.1-boost-1.50.patch52
-rw-r--r--sci-biology/mira/files/mira-3.4.0.2-boost-1.50.patch24
-rw-r--r--sci-biology/mira/files/mira-4.0.2-cout.patch16
-rw-r--r--sci-biology/mira/metadata.xml8
-rw-r--r--sci-biology/mira/mira-4.0.2.ebuild77
-rw-r--r--sci-biology/mosaik/Manifest2
-rw-r--r--sci-biology/mosaik/metadata.xml8
-rw-r--r--sci-biology/mosaik/mosaik-1.0.1367.ebuild34
-rw-r--r--sci-biology/mosaik/mosaik-1.0.1388.ebuild38
-rw-r--r--sci-biology/mothur/Manifest2
-rw-r--r--sci-biology/mothur/files/mothur-1.27.0-makefile.patch52
-rw-r--r--sci-biology/mothur/files/mothur-1.27.0-overflows.patch93
-rw-r--r--sci-biology/mothur/metadata.xml5
-rw-r--r--sci-biology/mothur/mothur-1.27.0-r1.ebuild44
-rw-r--r--sci-biology/mothur/mothur-1.6.0.ebuild33
-rw-r--r--sci-biology/mrbayes/Manifest1
-rw-r--r--sci-biology/mrbayes/files/mb_readline_312.patch37
-rw-r--r--sci-biology/mrbayes/metadata.xml18
-rw-r--r--sci-biology/mrbayes/mrbayes-3.1.2-r1.ebuild52
-rw-r--r--sci-biology/mrbayes/mrbayes-3.1.2-r2.ebuild62
-rw-r--r--sci-biology/mummer/Manifest3
-rw-r--r--sci-biology/mummer/files/3.22-ldflags.patch16
-rw-r--r--sci-biology/mummer/files/3.22-prll.patch56
-rw-r--r--sci-biology/mummer/files/mummer-3.20-gcc43.patch12
-rw-r--r--sci-biology/mummer/metadata.xml8
-rw-r--r--sci-biology/mummer/mummer-3.20.ebuild58
-rw-r--r--sci-biology/mummer/mummer-3.21.ebuild53
-rw-r--r--sci-biology/mummer/mummer-3.22-r1.ebuild64
-rw-r--r--sci-biology/muscle/Manifest1
-rw-r--r--sci-biology/muscle/files/3.7-bufferoverflow.patch26
-rw-r--r--sci-biology/muscle/files/3.8.31-make.patch26
-rw-r--r--sci-biology/muscle/metadata.xml5
-rw-r--r--sci-biology/muscle/muscle-3.8.31.ebuild33
-rw-r--r--sci-biology/ncbi-tools/Manifest1
-rw-r--r--sci-biology/ncbi-tools/files/21ncbi-r16
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-2.2.26-_DEFAULT_SOURCE.patch81
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-2.2.26-bfr-overflow.patch103
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-2.2.26-format-security.patch124
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-asn2all.patch27
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-extra_vib.patch37
-rw-r--r--sci-biology/ncbi-tools/files/ncbi-tools-lop.patch15
-rw-r--r--sci-biology/ncbi-tools/files/ncbirc2
-rw-r--r--sci-biology/ncbi-tools/metadata.xml5
-rw-r--r--sci-biology/ncbi-tools/ncbi-tools-2.2.26-r2.ebuild165
-rw-r--r--sci-biology/newick-utils/Manifest2
-rw-r--r--sci-biology/newick-utils/metadata.xml5
-rw-r--r--sci-biology/newick-utils/newick-utils-1.3.0.ebuild25
-rw-r--r--sci-biology/newick-utils/newick-utils-1.5.0.ebuild25
-rw-r--r--sci-biology/njplot/Manifest1
-rw-r--r--sci-biology/njplot/files/njplot-2.3-buildsystem.patch59
-rw-r--r--sci-biology/njplot/files/njplot-2.3-format-security.patch16
-rw-r--r--sci-biology/njplot/metadata.xml12
-rw-r--r--sci-biology/njplot/njplot-2.3-r1.ebuild35
-rw-r--r--sci-biology/njplot/njplot-2.3.ebuild34
-rw-r--r--sci-biology/pals/Manifest1
-rw-r--r--sci-biology/pals/metadata.xml5
-rw-r--r--sci-biology/pals/pals-1.0.ebuild30
-rw-r--r--sci-biology/paml/Manifest1
-rw-r--r--sci-biology/paml/metadata.xml5
-rw-r--r--sci-biology/paml/paml-4.4c-r1.ebuild48
-rw-r--r--sci-biology/phrap/Manifest1
-rw-r--r--sci-biology/phrap/metadata.xml5
-rw-r--r--sci-biology/phrap/phrap-1.080812-r1.ebuild42
-rw-r--r--sci-biology/phred/Manifest1
-rw-r--r--sci-biology/phred/metadata.xml5
-rw-r--r--sci-biology/phred/phred-071220.ebuild40
-rw-r--r--sci-biology/phylip/Manifest2
-rw-r--r--sci-biology/phylip/files/README.Gentoo15
-rw-r--r--sci-biology/phylip/metadata.xml5
-rw-r--r--sci-biology/phylip/phylip-3.69-r1.ebuild52
-rw-r--r--sci-biology/phylip/phylip-3.696.ebuild54
-rw-r--r--sci-biology/phyml/Manifest1
-rw-r--r--sci-biology/phyml/metadata.xml11
-rw-r--r--sci-biology/phyml/phyml-2.4.5-r2.ebuild34
-rw-r--r--sci-biology/picard/Manifest1
-rw-r--r--sci-biology/picard/files/1.103-gentoo.patch131
-rw-r--r--sci-biology/picard/metadata.xml9
-rw-r--r--sci-biology/picard/picard-1.103.ebuild70
-rw-r--r--sci-biology/piler/Manifest1
-rw-r--r--sci-biology/piler/files/piler-1.0-glibc-2.10.patch12
-rw-r--r--sci-biology/piler/metadata.xml5
-rw-r--r--sci-biology/piler/piler-1.0.ebuild36
-rw-r--r--sci-biology/pilercr/Manifest1
-rw-r--r--sci-biology/pilercr/files/pilercr-1.0-gcc43.patch33
-rw-r--r--sci-biology/pilercr/metadata.xml5
-rw-r--r--sci-biology/pilercr/pilercr-1.0.ebuild31
-rw-r--r--sci-biology/plink/Manifest2
-rw-r--r--sci-biology/plink/files/1.07-flags.patch44
-rw-r--r--sci-biology/plink/files/plink-1.07-gcc47.patch64
-rw-r--r--sci-biology/plink/metadata.xml13
-rw-r--r--sci-biology/plink/plink-1.07-r1.ebuild48
-rw-r--r--sci-biology/plink/plink-1.90_pre140514.ebuild55
-rw-r--r--sci-biology/poa/Manifest1
-rw-r--r--sci-biology/poa/files/2-respect-flags.patch26
-rw-r--r--sci-biology/poa/files/respect-cflags.patch13
-rw-r--r--sci-biology/poa/metadata.xml8
-rw-r--r--sci-biology/poa/poa-2-r1.ebuild45
-rw-r--r--sci-biology/prank/Manifest3
-rw-r--r--sci-biology/prank/files/prank-111130-gcc-4.7.patch15
-rw-r--r--sci-biology/prank/metadata.xml8
-rw-r--r--sci-biology/prank/prank-100701.ebuild34
-rw-r--r--sci-biology/prank/prank-111130.ebuild38
-rw-r--r--sci-biology/prank/prank-140603.ebuild37
-rw-r--r--sci-biology/primer3/Manifest2
-rw-r--r--sci-biology/primer3/files/primer3-1.1.4-ldflags.patch25
-rw-r--r--sci-biology/primer3/files/primer3-2.3.4-buildsystem.patch148
-rw-r--r--sci-biology/primer3/metadata.xml16
-rw-r--r--sci-biology/primer3/primer3-2.3.5.ebuild46
-rw-r--r--sci-biology/primer3/primer3-2.3.6.ebuild46
-rw-r--r--sci-biology/prints/Manifest1
-rw-r--r--sci-biology/prints/metadata.xml16
-rw-r--r--sci-biology/prints/prints-39.0.ebuild43
-rw-r--r--sci-biology/probcons/Manifest1
-rw-r--r--sci-biology/probcons/files/gcc-4.3.patch44
-rw-r--r--sci-biology/probcons/files/probcons-1.12-cxxflags.patch47
-rw-r--r--sci-biology/probcons/files/probcons-1.12-gcc-4.6.patch15
-rw-r--r--sci-biology/probcons/metadata.xml5
-rw-r--r--sci-biology/probcons/probcons-1.12-r1.ebuild53
-rw-r--r--sci-biology/prodigal/Manifest2
-rw-r--r--sci-biology/prodigal/metadata.xml8
-rw-r--r--sci-biology/prodigal/prodigal-2.50.ebuild30
-rw-r--r--sci-biology/prodigal/prodigal-2.60.ebuild30
-rw-r--r--sci-biology/profphd/Manifest2
-rw-r--r--sci-biology/profphd/files/profphd-1.0.39-perl.patch16
-rw-r--r--sci-biology/profphd/metadata.xml5
-rw-r--r--sci-biology/profphd/profphd-1.0.39.ebuild38
-rw-r--r--sci-biology/profphd/profphd-1.0.40.ebuild38
-rw-r--r--sci-biology/prosite/Manifest4
-rw-r--r--sci-biology/prosite/metadata.xml15
-rw-r--r--sci-biology/prosite/prosite-19.36.ebuild42
-rw-r--r--sci-biology/prosite/prosite-20.36.ebuild41
-rw-r--r--sci-biology/prosite/prosite-20.52.ebuild41
-rw-r--r--sci-biology/prosite/prosite-20.72.ebuild41
-rw-r--r--sci-biology/psipred/Manifest7
-rw-r--r--sci-biology/psipred/files/2.6.1-Makefile.patch42
-rw-r--r--sci-biology/psipred/files/2.6.1-path.patch34
-rw-r--r--sci-biology/psipred/files/3.0-path.patch38
-rw-r--r--sci-biology/psipred/files/3.1-Makefile.patch38
-rw-r--r--sci-biology/psipred/files/3.1-fgets.patch13
-rw-r--r--sci-biology/psipred/files/3.1-path.patch38
-rw-r--r--sci-biology/psipred/files/3.2-fgets.patch13
-rw-r--r--sci-biology/psipred/metadata.xml8
-rw-r--r--sci-biology/psipred/psipred-3.1.ebuild51
-rw-r--r--sci-biology/psipred/psipred-3.2.1.ebuild52
-rw-r--r--sci-biology/psipred/psipred-3.2.ebuild51
-rw-r--r--sci-biology/psipred/psipred-3.3.ebuild55
-rw-r--r--sci-biology/psipred/psipred-3.4.ebuild56
-rw-r--r--sci-biology/psipred/psipred-3.5.ebuild56
-rw-r--r--sci-biology/pysam/Manifest1
-rw-r--r--sci-biology/pysam/metadata.xml8
-rw-r--r--sci-biology/pysam/pysam-0.6-r1.ebuild25
-rw-r--r--sci-biology/qrna/Manifest1
-rw-r--r--sci-biology/qrna/files/26qrna1
-rw-r--r--sci-biology/qrna/files/qrna-2.0.3c-glibc-2.10.patch328
-rw-r--r--sci-biology/qrna/files/qrna-2.0.3c-ldflags.patch28
-rw-r--r--sci-biology/qrna/metadata.xml5
-rw-r--r--sci-biology/qrna/qrna-2.0.3c-r1.ebuild57
-rw-r--r--sci-biology/raxml/Manifest1
-rw-r--r--sci-biology/raxml/files/raxml-7.2.5-makefile.patch29
-rw-r--r--sci-biology/raxml/files/raxml-7.2.6-makefile.patch29
-rw-r--r--sci-biology/raxml/metadata.xml5
-rw-r--r--sci-biology/raxml/raxml-7.2.6.ebuild43
-rw-r--r--sci-biology/readseq/Manifest2
-rw-r--r--sci-biology/readseq/files/20080420-no-bundling.patch14
-rw-r--r--sci-biology/readseq/metadata.xml9
-rw-r--r--sci-biology/readseq/readseq-20080420-r1.ebuild42
-rw-r--r--sci-biology/readseq/readseq-20100513.ebuild38
-rw-r--r--sci-biology/rebase/Manifest2
-rw-r--r--sci-biology/rebase/metadata.xml16
-rw-r--r--sci-biology/rebase/rebase-1507.ebuild46
-rw-r--r--sci-biology/rebase/rebase-1508.ebuild46
-rw-r--r--sci-biology/recon/Manifest1
-rw-r--r--sci-biology/recon/files/1.06-buffer-overflow.patch13
-rw-r--r--sci-biology/recon/files/recon-1.06-respect.patch24
-rw-r--r--sci-biology/recon/metadata.xml5
-rw-r--r--sci-biology/recon/recon-1.06-r1.ebuild36
-rw-r--r--sci-biology/recon/recon-1.06-r2.ebuild39
-rw-r--r--sci-biology/repeatmasker-libraries/Manifest1
-rw-r--r--sci-biology/repeatmasker-libraries/metadata.xml5
-rw-r--r--sci-biology/repeatmasker-libraries/repeatmasker-libraries-20120418.ebuild35
-rw-r--r--sci-biology/repeatmasker/Manifest1
-rw-r--r--sci-biology/repeatmasker/metadata.xml5
-rw-r--r--sci-biology/repeatmasker/repeatmasker-4.0.1.ebuild59
-rw-r--r--sci-biology/rmblast/Manifest1
-rw-r--r--sci-biology/rmblast/files/rmblast-1.2-gcc47.patch865
-rw-r--r--sci-biology/rmblast/metadata.xml5
-rw-r--r--sci-biology/rmblast/rmblast-1.2-r1.ebuild46
-rw-r--r--sci-biology/rnaview/Manifest1
-rw-r--r--sci-biology/rnaview/files/rnaview-20040713-implicit.patch13
-rw-r--r--sci-biology/rnaview/files/rnaview-20040713-makefile.patch87
-rw-r--r--sci-biology/rnaview/metadata.xml13
-rw-r--r--sci-biology/rnaview/rnaview-20040713-r2.ebuild34
-rw-r--r--sci-biology/rnaview/rnaview-20040713-r3.ebuild31
-rw-r--r--sci-biology/rnaview/rnaview-20040713.ebuild39
-rw-r--r--sci-biology/samtools/Manifest5
-rw-r--r--sci-biology/samtools/files/samtools-0.1.19-buildsystem.patch183
-rw-r--r--sci-biology/samtools/files/samtools-1.0-buildsystem.patch59
-rw-r--r--sci-biology/samtools/files/samtools-1.1-buildsystem.patch153
-rw-r--r--sci-biology/samtools/files/samtools-1.2-buildsystem.patch193
-rw-r--r--sci-biology/samtools/metadata.xml8
-rw-r--r--sci-biology/samtools/samtools-0.1.12.ebuild31
-rw-r--r--sci-biology/samtools/samtools-0.1.19-r2.ebuild61
-rw-r--r--sci-biology/samtools/samtools-1.0-r1.ebuild73
-rw-r--r--sci-biology/samtools/samtools-1.0.ebuild69
-rw-r--r--sci-biology/samtools/samtools-1.1.ebuild83
-rw-r--r--sci-biology/samtools/samtools-1.2.ebuild83
-rw-r--r--sci-biology/seaview/Manifest1
-rw-r--r--sci-biology/seaview/metadata.xml12
-rw-r--r--sci-biology/seaview/seaview-4.3.5.ebuild77
-rw-r--r--sci-biology/seqan/Manifest3
-rw-r--r--sci-biology/seqan/files/seqan-1.4.2-include.patch16
-rw-r--r--sci-biology/seqan/files/seqan-1.4.2-shared.patch22
-rw-r--r--sci-biology/seqan/files/seqan-2.0.0-zlib.patch15
-rw-r--r--sci-biology/seqan/metadata.xml5
-rw-r--r--sci-biology/seqan/seqan-1.3.1-r1.ebuild42
-rw-r--r--sci-biology/seqan/seqan-1.4.2.ebuild69
-rw-r--r--sci-biology/seqan/seqan-2.0.0.ebuild51
-rw-r--r--sci-biology/shrimp/Manifest2
-rw-r--r--sci-biology/shrimp/metadata.xml5
-rw-r--r--sci-biology/shrimp/shrimp-2.0.1.ebuild55
-rw-r--r--sci-biology/shrimp/shrimp-2.2.3.ebuild83
-rw-r--r--sci-biology/sibsim4/Manifest1
-rw-r--r--sci-biology/sibsim4/metadata.xml8
-rw-r--r--sci-biology/sibsim4/sibsim4-0.20.ebuild36
-rw-r--r--sci-biology/sim4/Manifest1
-rw-r--r--sci-biology/sim4/metadata.xml21
-rw-r--r--sci-biology/sim4/sim4-20030921-r1.ebuild26
-rw-r--r--sci-biology/sim4/sim4-20030921.ebuild19
-rw-r--r--sci-biology/snpfile/Manifest1
-rw-r--r--sci-biology/snpfile/files/snpfile-2.0.1-gcc44.patch12
-rw-r--r--sci-biology/snpfile/files/snpfile-2.0.1-gentoo.diff533
-rw-r--r--sci-biology/snpfile/files/snpfile-2.0.1-gold.patch23
-rw-r--r--sci-biology/snpfile/metadata.xml5
-rw-r--r--sci-biology/snpfile/snpfile-2.0.1-r1.ebuild36
-rw-r--r--sci-biology/snpfile/snpfile-2.0.1.ebuild26
-rw-r--r--sci-biology/stride/Manifest2
-rw-r--r--sci-biology/stride/files/stride-LDFLAGS.patch11
-rw-r--r--sci-biology/stride/metadata.xml5
-rw-r--r--sci-biology/stride/stride-20011129-r1.ebuild38
-rw-r--r--sci-biology/t-coffee/Manifest2
-rw-r--r--sci-biology/t-coffee/files/t-coffee-9.03.1318-flags.patch21
-rw-r--r--sci-biology/t-coffee/metadata.xml14
-rw-r--r--sci-biology/t-coffee/t-coffee-11.00.ebuild54
-rw-r--r--sci-biology/t-coffee/t-coffee-9.03.1318-r1.ebuild57
-rw-r--r--sci-biology/tophat/Manifest6
-rw-r--r--sci-biology/tophat/files/tophat-2.0.2-flags.patch124
-rw-r--r--sci-biology/tophat/files/tophat-2.0.8-flags.patch105
-rw-r--r--sci-biology/tophat/files/tophat-2.0.9-flags.patch109
-rw-r--r--sci-biology/tophat/metadata.xml8
-rw-r--r--sci-biology/tophat/tophat-1.0.12.ebuild38
-rw-r--r--sci-biology/tophat/tophat-1.4.1.ebuild32
-rw-r--r--sci-biology/tophat/tophat-2.0.0.ebuild31
-rw-r--r--sci-biology/tophat/tophat-2.0.2.ebuild31
-rw-r--r--sci-biology/tophat/tophat-2.0.8.ebuild40
-rw-r--r--sci-biology/tophat/tophat-2.0.9.ebuild46
-rw-r--r--sci-biology/transfac/Manifest1
-rw-r--r--sci-biology/transfac/metadata.xml13
-rw-r--r--sci-biology/transfac/transfac-3.2.ebuild41
-rw-r--r--sci-biology/tree-puzzle/Manifest1
-rw-r--r--sci-biology/tree-puzzle/files/tree-puzzle-impl-dec.patch14
-rw-r--r--sci-biology/tree-puzzle/metadata.xml25
-rw-r--r--sci-biology/tree-puzzle/tree-puzzle-5.2.ebuild57
-rw-r--r--sci-biology/treeviewx/Manifest1
-rw-r--r--sci-biology/treeviewx/files/treeviewx-0.5.1-gcc4.3.patch77
-rw-r--r--sci-biology/treeviewx/files/treeviewx-0.5.1-wx28.patch14
-rw-r--r--sci-biology/treeviewx/files/treeviewx-gcc-3.4.patch73
-rw-r--r--sci-biology/treeviewx/files/treeviewx-wxt.patch50
-rw-r--r--sci-biology/treeviewx/metadata.xml11
-rw-r--r--sci-biology/treeviewx/treeviewx-0.5.1-r2.ebuild32
-rw-r--r--sci-biology/trf/Manifest1
-rw-r--r--sci-biology/trf/metadata.xml5
-rw-r--r--sci-biology/trf/trf-4.04.ebuild37
-rw-r--r--sci-biology/trnascan-se/Manifest2
-rw-r--r--sci-biology/trnascan-se/files/trnascan-se-1.23-glibc-2.10.patch292
-rw-r--r--sci-biology/trnascan-se/files/trnascan-se-1.23-ldflags.patch26
-rw-r--r--sci-biology/trnascan-se/files/trnascan-se-1.31-ldflags.patch26
-rw-r--r--sci-biology/trnascan-se/metadata.xml12
-rw-r--r--sci-biology/trnascan-se/trnascan-se-1.23-r2.ebuild45
-rw-r--r--sci-biology/trnascan-se/trnascan-se-1.31.ebuild54
-rw-r--r--sci-biology/uchime/Manifest1
-rw-r--r--sci-biology/uchime/files/CMakeLists.txt11
-rw-r--r--sci-biology/uchime/metadata.xml15
-rw-r--r--sci-biology/uchime/uchime-4.2.40.ebuild24
-rw-r--r--sci-biology/ucsc-genome-browser/Manifest1
-rw-r--r--sci-biology/ucsc-genome-browser/metadata.xml8
-rw-r--r--sci-biology/ucsc-genome-browser/ucsc-genome-browser-260.ebuild106
-rw-r--r--sci-biology/unafold/Manifest1
-rw-r--r--sci-biology/unafold/metadata.xml5
-rw-r--r--sci-biology/unafold/unafold-3.8-r1.ebuild28
-rw-r--r--sci-biology/unafold/unafold-3.8.ebuild32
-rw-r--r--sci-biology/update-blastdb/Manifest1
-rw-r--r--sci-biology/update-blastdb/metadata.xml5
-rw-r--r--sci-biology/update-blastdb/update-blastdb-12.0.0.ebuild29
-rw-r--r--sci-biology/vaal/Manifest2
-rw-r--r--sci-biology/vaal/files/vaal-1.2-as-needed.patch22
-rw-r--r--sci-biology/vaal/files/vaal-1.2-gcc-x86-no-autocast.patch39
-rw-r--r--sci-biology/vaal/files/vaal-1.2-respect-flags.patch60
-rw-r--r--sci-biology/vaal/files/vaal-1.6-gcc47.patch153
-rw-r--r--sci-biology/vaal/files/vaal-1.6-respect-flags.patch12
-rw-r--r--sci-biology/vaal/metadata.xml5
-rw-r--r--sci-biology/vaal/vaal-46233.ebuild42
-rw-r--r--sci-biology/vcftools/Manifest1
-rw-r--r--sci-biology/vcftools/files/vcftools-0.1.12b-buildsystem.patch53
-rw-r--r--sci-biology/vcftools/metadata.xml8
-rw-r--r--sci-biology/vcftools/vcftools-0.1.12b.ebuild45
-rw-r--r--sci-biology/velvet/Manifest2
-rw-r--r--sci-biology/velvet/files/velvet-0.7.62-gentoo.diff126
-rw-r--r--sci-biology/velvet/files/velvet-1.0.18-gentoo-r1.diff72
-rw-r--r--sci-biology/velvet/metadata.xml5
-rw-r--r--sci-biology/velvet/velvet-1.0.18-r1.ebuild54
-rw-r--r--sci-biology/velvet/velvet-1.2.10.ebuild73
-rw-r--r--sci-biology/vienna-rna/Manifest2
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.6.5-c-fixes.patch22
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.7.2-LDFLAGS.patch24
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.3-disable-gd.patch16
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.3-gcc4.3.patch76
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.4-bindir.patch10
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.4-implicits.patch47
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.4-jobserver-fix.patch18
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.4-overflows.patch26
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-1.8.5-setup.py27
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-2.1.1-bindir.patch10
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-2.1.1-impl-decl.patch15
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-2.1.1-prll.patch30
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-2.1.1-setup.py27
-rw-r--r--sci-biology/vienna-rna/files/vienna-rna-2.1.8-bindir.patch10
-rw-r--r--sci-biology/vienna-rna/metadata.xml22
-rw-r--r--sci-biology/vienna-rna/vienna-rna-2.1.1.ebuild113
-rw-r--r--sci-biology/vienna-rna/vienna-rna-2.1.8.ebuild114
-rw-r--r--sci-biology/wgs-assembler/Manifest3
-rw-r--r--sci-biology/wgs-assembler/files/wgs-assembler-7.0-build.patch229
-rw-r--r--sci-biology/wgs-assembler/metadata.xml8
-rw-r--r--sci-biology/wgs-assembler/wgs-assembler-5.4.ebuild70
-rw-r--r--sci-biology/wgs-assembler/wgs-assembler-6.1.ebuild70
-rw-r--r--sci-biology/wgs-assembler/wgs-assembler-7.0-r1.ebuild75
-rw-r--r--sci-biology/wgs-assembler/wgs-assembler-7.0.ebuild70
-rw-r--r--sci-biology/wise/Manifest1
-rw-r--r--sci-biology/wise/files/wise-2.2.0-glibc-2.10.patch301
-rw-r--r--sci-biology/wise/files/wise-2.4.0_alpha-cflags.patch407
-rw-r--r--sci-biology/wise/files/wise-2.4.0_alpha-glibc-2.10.patch302
-rw-r--r--sci-biology/wise/files/wise-api.tex.patch38
-rw-r--r--sci-biology/wise/files/wise-env1
-rw-r--r--sci-biology/wise/metadata.xml5
-rw-r--r--sci-biology/wise/wise-2.4.0_alpha.ebuild73
-rw-r--r--sci-biology/yass/Manifest1
-rw-r--r--sci-biology/yass/files/1.14-as-needed.patch207
-rw-r--r--sci-biology/yass/metadata.xml9
-rw-r--r--sci-biology/yass/yass-1.14-r1.ebuild36
-rw-r--r--sci-biology/yass/yass-1.14.ebuild22
801 files changed, 30735 insertions, 0 deletions
diff --git a/sci-biology/ApE/ApE-2.0.7-r1.ebuild b/sci-biology/ApE/ApE-2.0.7-r1.ebuild
new file mode 100644
index 000000000000..c76b28f8893a
--- /dev/null
+++ b/sci-biology/ApE/ApE-2.0.7-r1.ebuild
@@ -0,0 +1,54 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils
+
+DESCRIPTION="A Plasmid Editor"
+HOMEPAGE="http://www.biology.utah.edu/jorgensen/wayned/ape/"
+SRC_URI="http://www.biology.utah.edu/jorgensen/wayned/ape/Download/Linux/ApE_linux_current.zip -> ${P}.zip"
+
+LICENSE="ApE"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+DEPEND="app-arch/unzip"
+RDEPEND="
+ dev-lang/tcl:0
+ dev-lang/tk:0"
+
+RESTRICT="mirror"
+
+S="${WORKDIR}/ApE Linux/"
+
+src_compile() { :; }
+
+src_install() {
+ cat >> "${T}/ApE" <<- "EOF"
+ #!/bin/bash
+ cmdArgs=""
+
+ # AppMain.tcl searches files relative to the directory where it resides.
+ # Add absolute path to file here, if necessary.
+ for rfpath in "$@"; do
+ afpath="$PWD/${rfpath}"
+ if test -r "${afpath}"; then
+ cmdArgs="${cmdArgs} \"${afpath}\"";
+ else
+ cmdArgs="${cmdArgs} \"${rfpath}\"";
+ fi
+ done
+
+ eval exec tclsh "\"/usr/share/ApE-2.0.7/AppMain.tcl\"" "${cmdArgs}"
+ EOF
+
+ dobin "${T}/ApE"
+ insinto "/usr/share/${P}"
+ doins -r "${WORKDIR}"/ApE\ Linux/*
+ make_desktop_entry ${PN} ${PN} \
+ "/usr/share/${P}/Accessory Files/Icons and images/monkey_icon.gif" \
+ "Science"
+}
diff --git a/sci-biology/ApE/Manifest b/sci-biology/ApE/Manifest
new file mode 100644
index 000000000000..c8bc584062a7
--- /dev/null
+++ b/sci-biology/ApE/Manifest
@@ -0,0 +1 @@
+DIST ApE-2.0.7.zip 318454 SHA256 9d718562ef250b68dfad1de7d4179540fc04c001b0fdc5e9bd70f3605561bc32 SHA512 073e3f96badf4888c10a7c7eb453a3775d5bb9136b0bd836d37d1be784847f887e0c68b37325f430eebfb90c2d94021f10d4e8ede92de89b1ab1ddc1ffdbc254 WHIRLPOOL d13e8a997c36f8e7ac951a17c195a714a243292f9a99f524758b09b1fdc9f436b11cf1124ac1a3527ff70aa8cc6dc9ac516a910246f9f6e4f8376c78e8b44013
diff --git a/sci-biology/ApE/metadata.xml b/sci-biology/ApE/metadata.xml
new file mode 100644
index 000000000000..4252fbfae02e
--- /dev/null
+++ b/sci-biology/ApE/metadata.xml
@@ -0,0 +1,10 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <maintainer>
+ <email>je_fro@gentoo.org</email>
+ <name>Jeff Gardner</name>
+ </maintainer>
+ <longdescription lang="en">
+ </longdescription>
+</pkgmetadata>
diff --git a/sci-biology/GBrowse/GBrowse-2.48-r1.ebuild b/sci-biology/GBrowse/GBrowse-2.48-r1.ebuild
new file mode 100644
index 000000000000..a3c0228b819d
--- /dev/null
+++ b/sci-biology/GBrowse/GBrowse-2.48-r1.ebuild
@@ -0,0 +1,72 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+MODULE_AUTHOR=LDS
+inherit perl-module webapp
+
+DESCRIPTION="Generic Model Organism Database Project - The Generic Genome Browser"
+HOMEPAGE="http://gmod.org/wiki/GBrowse"
+KEYWORDS="~amd64 ~x86"
+IUSE="-minimal mysql postgres +sqlite"
+
+SLOT="0"
+WEBAPP_MANUAL_SLOT="yes"
+
+CDEPEND="!<sci-biology/GBrowse-2.44-r1
+ >=sci-biology/bioperl-1.6.9
+ >=dev-perl/Bio-Graphics-2.09
+ >=dev-perl/GD-2.07
+ >=dev-perl/CGI-Session-4.02
+ dev-perl/IO-String
+ dev-perl/JSON
+ dev-perl/libwww-perl
+ dev-perl/Statistics-Descriptive
+ !minimal? (
+ dev-perl/Bio-Das
+ >=dev-perl/Bio-SamTools-1.20
+ dev-perl/Crypt-SSLeay
+ dev-perl/DB_File-Lock
+ dev-perl/DBI
+ mysql? ( dev-perl/DBD-mysql )
+ postgres? ( dev-perl/DBD-Pg )
+ sqlite? ( dev-perl/DBD-SQLite )
+ dev-perl/FCGI
+ dev-perl/File-NFSLock
+ dev-perl/GD-SVG
+ dev-perl/Net-OpenID-Consumer
+ dev-perl/Net-SMTP-SSL
+ )"
+# >=dev-perl/Bio-DB-BigFile-1.00 - requires jklib to compile
+DEPEND="dev-perl/Module-Build
+ dev-perl/Capture-Tiny
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+PATCHES=( "${FILESDIR}"/GBrowseInstall.pm-2.39.patch )
+
+src_configure() {
+ webapp_src_preinst
+
+# myconf="--install_base=${D}/usr" or "--install_base=/opt/gbrowse"
+ myconf="--conf=/etc/gbrowse2"
+ myconf="${myconf} --htdocs=${MY_HTDOCSDIR}"
+ myconf="${myconf} --cgibin=${MY_CGIBINDIR}"
+ myconf="${myconf} --tmp=/var/tmp/gbrowse2"
+ myconf="${myconf} --persistent=/var/db/gbrowse2"
+ myconf="${myconf} --databases=/var/db/gbrowse2/databases"
+ myconf="${myconf} --installconf=no"
+ myconf="${myconf} --installetc=no"
+ perl-module_src_configure
+}
+
+src_install() {
+ dodir /var/tmp/gbrowse2
+ dodir /var/db/gbrowse2/sessions
+ dodir /var/db/gbrowse2/userdata
+ webapp_serverowned -R /var/tmp/gbrowse2 /var/db/gbrowse2
+ perl-module_src_install
+ webapp_src_install
+}
diff --git a/sci-biology/GBrowse/Manifest b/sci-biology/GBrowse/Manifest
new file mode 100644
index 000000000000..204fe59d5aa7
--- /dev/null
+++ b/sci-biology/GBrowse/Manifest
@@ -0,0 +1 @@
+DIST GBrowse-2.48.tar.gz 11958127 SHA256 02772c5a7a31ed87733e21278efec2edd3bd6ee8a4bec9b002233e57f6dc9681 SHA512 d5a07caf1517fb15741e8e6056669763eb04678a42637a9e90788c91e74fb34515b5f86aac10a00f29d8848aceb19d6f5f7258d2dda0e281feee550e9e2fb3db WHIRLPOOL 5a3ec31de1582c4c551c76908ca8e8024c8d3311404f0c94f7b75a391c340da0ededd80df34be3f10f581902ba1408d84e3e65218f46322546623e15a1020135
diff --git a/sci-biology/GBrowse/files/GBrowseInstall.pm-2.39.patch b/sci-biology/GBrowse/files/GBrowseInstall.pm-2.39.patch
new file mode 100644
index 000000000000..5aa0be9df918
--- /dev/null
+++ b/sci-biology/GBrowse/files/GBrowseInstall.pm-2.39.patch
@@ -0,0 +1,72 @@
+diff -durr GBrowse-2.39-orig/install_util/GBrowseInstall.pm GBrowse-2.39/install_util/GBrowseInstall.pm
+--- GBrowse-2.39-orig/install_util/GBrowseInstall.pm 2011-07-19 20:14:52.434608020 +0000
++++ GBrowse-2.39/install_util/GBrowseInstall.pm 2011-07-19 21:02:13.685107753 +0000
+@@ -454,33 +454,33 @@
+ $gid =~ /^(\d+)$/;
+ $gid = $1;
+
+- unless (chown $uid,$gid,$tmp) {
+- $self->ownership_warning($tmp,$user);
+- }
++# unless (chown $uid,$gid,$tmp) {
++# $self->ownership_warning($tmp,$user);
++# }
+
+ my $htdocs_i = File::Spec->catfile($self->install_path->{htdocs},'i');
+ my $images = File::Spec->catfile($tmp,'images');
+ my $htdocs = $self->install_path->{htdocs};
+- chown $uid,-1,$htdocs;
++# chown $uid,-1,$htdocs;
+ {
+ local $> = $uid;
+- symlink($images,$htdocs_i); # so symlinkifowner match works!
++# symlink($images,$htdocs_i); # so symlinkifowner match works!
+ }
+- chown $>,-1,$self->install_path->{htdocs};
++# chown $>,-1,$self->install_path->{htdocs};
+
+ my $persistent = $self->install_path->{'persistent'};
+ my $sessions = File::Spec->catfile($persistent,'sessions');
+ my $userdata = File::Spec->catfile($persistent,'userdata');
+- mkpath([$sessions,$userdata],0711);
++# mkpath([$sessions,$userdata],0711);
+
+ my $databases = $self->install_path->{'databases'};
+
+- unless (chown $uid,$gid,glob(File::Spec->catfile($databases,'').'*')) {
+- $self->ownership_warning($databases,$user);
+- }
++# unless (chown $uid,$gid,glob(File::Spec->catfile($databases,'').'*')) {
++# $self->ownership_warning($databases,$user);
++# }
+
+- chmod 0755,File::Spec->catfile($self->install_path->{'etc'},'init.d','gbrowse-slave');
+- $self->fix_selinux;
++ # chmod 0755,File::Spec->catfile($self->install_path->{'etc'},'init.d','gbrowse-slave');
++ # $self->fix_selinux;
+
+ my $base = basename($self->install_path->{htdocs});
+
+@@ -489,14 +489,14 @@
+ my $metadb_script = File::Spec->catfile("bin", "gbrowse_metadb_config.pl");
+ my $perl = $self->perl;
+ my @inc = map{"-I$_"} split ':',$self->added_to_INC;
+- system $perl,@inc,$metadb_script;
+- system 'sudo','chown','-R',"$uid.$gid",$sessions,$userdata;
++# system $perl,@inc,$metadb_script;
++# system 'sudo','chown','-R',"$uid.$gid",$sessions,$userdata;
+
+- if (Module::Build->y_n(
+- "It is recommended that you restart Apache. Shall I try this for you?",'y'
+- )) {
+- system "sudo /etc/init.d/apache2 restart";
+- }
++# if (Module::Build->y_n(
++# "It is recommended that you restart Apache. Shall I try this for you?",'y'
++# )) {
++# system "sudo /etc/init.d/apache2 restart";
++# }
+
+ print STDERR "\n***INSTALLATION COMPLETE***\n";
+ print STDERR "Load http://localhost/$base for demo and documentation.\n";
+Only in GBrowse-2.39/install_util: GBrowseInstall.pm~
diff --git a/sci-biology/GBrowse/metadata.xml b/sci-biology/GBrowse/metadata.xml
new file mode 100644
index 000000000000..32b15c723f9d
--- /dev/null
+++ b/sci-biology/GBrowse/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+<herd>sci-biology</herd>
+<upstream>
+ <remote-id type="cpan">GBrowse</remote-id>
+</upstream>
+</pkgmetadata>
diff --git a/sci-biology/aaindex/Manifest b/sci-biology/aaindex/Manifest
new file mode 100644
index 000000000000..7b3eeafe5263
--- /dev/null
+++ b/sci-biology/aaindex/Manifest
@@ -0,0 +1 @@
+DIST aaindex-9.1.tar.bz2 133780 RMD160 6f5bd699de3c84bd366f9747f57712ba8aecf513 SHA1 7215e3dae85cd61919854ba5dd5abff29be91852 SHA256 ae2e5aec2fc47835f26c8d8b5776966464bc08a5fca422c130d8312880382caa
diff --git a/sci-biology/aaindex/aaindex-9.1.ebuild b/sci-biology/aaindex/aaindex-9.1.ebuild
new file mode 100644
index 000000000000..6c45282be145
--- /dev/null
+++ b/sci-biology/aaindex/aaindex-9.1.ebuild
@@ -0,0 +1,41 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+DESCRIPTION="Amino acid indices and similarity matrices"
+LICENSE="public-domain"
+HOMEPAGE="http://www.genome.ad.jp/aaindex"
+SRC_URI="mirror://gentoo/${P}.tar.bz2"
+
+SLOT="0"
+# Minimal build keeps only the indexed files (if applicable) and the
+# documentation. The non-indexed database is not installed.
+IUSE="emboss minimal"
+KEYWORDS="amd64 ppc x86 ~amd64-linux ~x86-linux ~ppc-macos ~sparc-solaris"
+
+DEPEND="emboss? ( sci-biology/emboss )"
+
+RDEPEND="${DEPEND}"
+
+src_compile() {
+ if use emboss; then
+ mkdir AAINDEX
+ echo
+ einfo "Indexing AAindex for usage with EMBOSS."
+ EMBOSS_DATA="." aaindexextract -auto -infile ${PN}1 || die \
+ "Indexing AAindex failed."
+ echo
+ fi
+}
+
+src_install() {
+ if ! use minimal; then
+ insinto /usr/share/${PN}
+ doins ${PN}{1,2,3} || die "Failed to install raw database."
+ fi
+ dodoc ${PN}.doc || die "Failed to install documentation."
+ if use emboss; then
+ insinto /usr/share/EMBOSS/data/AAINDEX
+ doins AAINDEX/* || die "Failed to install EMBOSS data files."
+ fi
+}
diff --git a/sci-biology/aaindex/metadata.xml b/sci-biology/aaindex/metadata.xml
new file mode 100644
index 000000000000..ccb567e64e02
--- /dev/null
+++ b/sci-biology/aaindex/metadata.xml
@@ -0,0 +1,22 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <longdescription>
+ Amino acid indices and similarity matrices maintained at Kyoto
+ University. An amino acid index is a set of 20 numerical values
+ representing any of the different physicochemical and biological
+ properties of amino acids. The AAindex1 section of the Amino Acid
+ Index Database is a collection of published indices together with the
+ result of cluster analysis using the correlation coefficient as the
+ distance between two indices. This section currently contains 494
+ indices. Another important feature of amino acids that can be
+ represented numerically is the similarity between amino acids. Thus, a
+ similarity matrix, also called a mutation matrix, is a set of 210
+ numerical values, 20 diagonal and 20x19/2 off-diagonal elements, used
+ for sequence alignments and similarity searches. The AAindex2 section
+ of the Amino Acid Index Database is a collection of published amino
+ acid mutation matrices together with the result of cluster analysis.
+ This section currently contains 83 matrices.
+ </longdescription>
+</pkgmetadata>
diff --git a/sci-biology/abyss/Manifest b/sci-biology/abyss/Manifest
new file mode 100644
index 000000000000..77dfde1ec9c8
--- /dev/null
+++ b/sci-biology/abyss/Manifest
@@ -0,0 +1,3 @@
+DIST abyss-1.3.3.tar.gz 621480 SHA256 60396e2c8813952ceb1c66a3ad7c87eda984aa1e4952a14265217d9f639706a0 SHA512 4ec7fdd24bdb1e3d66e2bda50929122ff347107010701703e81ca1609fb1b4913c713991b3fe84a48ccfbc069e126f4f4120aafbab81e54e567a95a2f1099fb2 WHIRLPOOL 35f6fdfe60b70316e67bcbbb0a9c67e952302333e9ec71d893f2de7a94482dca1a604dc8cfef1ecee49e464244bb5df7469a8ad7bdc37bd54ff455b0f75b7914
+DIST abyss-1.3.4.tar.gz 640545 SHA256 6b6ccb04baaa9d244dd67d95e1512a934d2e54fd28a539149b6845ed5c496baf SHA512 0fa4c14117699945e007412deaeeccca27124a210669accbc1444baf5a4de1a17e1f9b48e6ee43fefed63f0d56b933c847363e59a0fc2bad60ae6d603cd8c09e WHIRLPOOL 42b16f22bc47c8f29b07c256d504d6f58119c64fdcf0e198fd8b836ceb45139fd5cadc7feec72adf958800e55eb1065a449ce7dd288339887dcea4ab13623c01
+DIST abyss-1.3.6.tar.gz 678880 SHA256 4432a8b5046bdcb548b6f1b22069a6cade4dea26fc6f83ad5467548e4f3e7c95 SHA512 2c6d72e0227c4af2d5740a989168ad35a84b9236dc53b65a29a010c4e5f77e5c4bfaa38bfaa2f14fd530ae6df204294ff167bd40e79f61e8bad6a7489bf34ace WHIRLPOOL 0677b1fd4090ba155fb876c0047a1ccd2ec2e220950e1e9940e1f3df05ef0abd3ba2e3dbabd500d6fab39a8f7d94e02e0a07410934733682a70fa605d2a8bc07
diff --git a/sci-biology/abyss/abyss-1.3.3.ebuild b/sci-biology/abyss/abyss-1.3.3.ebuild
new file mode 100644
index 000000000000..08a82e2f692a
--- /dev/null
+++ b/sci-biology/abyss/abyss-1.3.3.ebuild
@@ -0,0 +1,41 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="4"
+
+inherit autotools eutils toolchain-funcs
+
+DESCRIPTION="Assembly By Short Sequences - a de novo, parallel, paired-end sequence assembler"
+HOMEPAGE="http://www.bcgsc.ca/platform/bioinfo/software/abyss/"
+SRC_URI="http://www.bcgsc.ca/downloads/abyss/${P}.tar.gz"
+
+LICENSE="abyss"
+SLOT="0"
+IUSE="+mpi openmp"
+KEYWORDS="amd64 x86"
+
+DEPEND="
+ dev-cpp/sparsehash
+ mpi? ( virtual/mpi )"
+RDEPEND="${DEPEND}"
+
+# todo: --enable-maxk=N configure option
+# todo: fix automagic mpi toggling
+
+src_prepare() {
+ tc-export AR
+ epatch \
+ "${FILESDIR}"/${P}-gcc-4.7.patch \
+ "${FILESDIR}"/${P}-ac_prog_ar.patch
+
+ sed -i -e "s/-Werror//" configure.ac || die #365195
+ sed -i -e "/dist_pkgdoc_DATA/d" Makefile.am || die
+ eautoreconf
+}
+
+src_configure() {
+ econf \
+ --docdir="${EPREFIX}/usr/share/doc/${PF}" \
+ $(use_enable openmp)
+}
diff --git a/sci-biology/abyss/abyss-1.3.4.ebuild b/sci-biology/abyss/abyss-1.3.4.ebuild
new file mode 100644
index 000000000000..e230da8847ff
--- /dev/null
+++ b/sci-biology/abyss/abyss-1.3.4.ebuild
@@ -0,0 +1,46 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils
+
+DESCRIPTION="Assembly By Short Sequences - a de novo, parallel, paired-end sequence assembler"
+HOMEPAGE="http://www.bcgsc.ca/platform/bioinfo/software/abyss/"
+SRC_URI="http://www.bcgsc.ca/downloads/abyss/${P}.tar.gz"
+
+LICENSE="abyss"
+SLOT="0"
+IUSE="+mpi openmp"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ dev-cpp/sparsehash
+ mpi? ( virtual/mpi )"
+RDEPEND="${DEPEND}"
+
+# todo: --enable-maxk=N configure option
+# todo: fix automagic mpi toggling
+
+PATCHES=(
+ "${FILESDIR}"/${P}-gcc-4.7.patch
+ "${FILESDIR}"/${PN}-1.3.3-ac_prog_ar.patch
+ )
+
+src_prepare() {
+ tc-export AR
+ sed -i -e "s/-Werror//" configure.ac || die #365195
+ sed -i -e "/dist_pkgdoc_DATA/d" Makefile.am || die
+ autotools-utils_src_prepare
+}
+
+src_configure() {
+ local myeconfargs=(
+ --docdir="${EPREFIX}/usr/share/doc/${PF}"
+ $(use_enable openmp)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/abyss/abyss-1.3.6.ebuild b/sci-biology/abyss/abyss-1.3.6.ebuild
new file mode 100644
index 000000000000..04dcc7ce6a25
--- /dev/null
+++ b/sci-biology/abyss/abyss-1.3.6.ebuild
@@ -0,0 +1,47 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils
+
+DESCRIPTION="Assembly By Short Sequences - a de novo, parallel, paired-end sequence assembler"
+HOMEPAGE="http://www.bcgsc.ca/platform/bioinfo/software/abyss/"
+SRC_URI="http://www.bcgsc.ca/downloads/abyss/${P}.tar.gz"
+
+LICENSE="abyss"
+SLOT="0"
+IUSE="+mpi openmp"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ dev-cpp/sparsehash
+ dev-libs/boost
+ mpi? ( virtual/mpi )"
+RDEPEND="${DEPEND}"
+
+# todo: --enable-maxk=N configure option
+# todo: fix automagic mpi toggling
+
+PATCHES=(
+ "${FILESDIR}"/${P}-gcc-4.7.patch
+ "${FILESDIR}"/${P}-ac_prog_ar.patch
+ )
+
+src_prepare() {
+ tc-export AR
+ sed -i -e "s/-Werror//" configure.ac || die #365195
+ sed -i -e "/dist_pkgdoc_DATA/d" Makefile.am || die
+ autotools-utils_src_prepare
+}
+
+src_configure() {
+ local myeconfargs=(
+ --docdir="${EPREFIX}/usr/share/doc/${PF}"
+ $(use_enable openmp)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/abyss/files/abyss-1.3.3-ac_prog_ar.patch b/sci-biology/abyss/files/abyss-1.3.3-ac_prog_ar.patch
new file mode 100644
index 000000000000..300868f52b76
--- /dev/null
+++ b/sci-biology/abyss/files/abyss-1.3.3-ac_prog_ar.patch
@@ -0,0 +1,18 @@
+ configure.ac | 4 ++++
+ 1 file changed, 4 insertions(+)
+
+diff --git a/configure.ac b/configure.ac
+index 5c6cb92..b99bedd 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -12,6 +12,10 @@ AC_PROG_CPP
+ AC_PROG_CXX
+ AC_PROG_INSTALL
+ AC_PROG_RANLIB
++AN_MAKEVAR([AR], [AC_PROG_AR])
++AN_PROGRAM([ar], [AC_PROG_AR])
++AC_DEFUN([AC_PROG_AR], [AC_CHECK_TOOL(AR, ar, :)])
++AC_PROG_AR
+
+ # Checks for header files.
+ AC_CHECK_HEADERS([dlfcn.h fcntl.h float.h limits.h \
diff --git a/sci-biology/abyss/files/abyss-1.3.3-gcc-4.7.patch b/sci-biology/abyss/files/abyss-1.3.3-gcc-4.7.patch
new file mode 100644
index 000000000000..42066f7f2152
--- /dev/null
+++ b/sci-biology/abyss/files/abyss-1.3.3-gcc-4.7.patch
@@ -0,0 +1,15 @@
+ ParseAligns/abyss-fixmate.cc | 1 +
+ 1 files changed, 1 insertions(+), 0 deletions(-)
+
+diff --git a/ParseAligns/abyss-fixmate.cc b/ParseAligns/abyss-fixmate.cc
+index 506ea0c..a0a403c 100644
+--- a/ParseAligns/abyss-fixmate.cc
++++ b/ParseAligns/abyss-fixmate.cc
+@@ -15,6 +15,7 @@
+ #include <iterator>
+ #include <sstream>
+ #include <string>
++#include <unistd.h>
+
+ using namespace std;
+
diff --git a/sci-biology/abyss/files/abyss-1.3.4-gcc-4.7.patch b/sci-biology/abyss/files/abyss-1.3.4-gcc-4.7.patch
new file mode 100644
index 000000000000..c2cc35c31d98
--- /dev/null
+++ b/sci-biology/abyss/files/abyss-1.3.4-gcc-4.7.patch
@@ -0,0 +1,15 @@
+ ParseAligns/abyss-fixmate.cc | 1 +
+ 1 files changed, 1 insertions(+), 0 deletions(-)
+
+diff --git a/ParseAligns/abyss-fixmate.cc b/ParseAligns/abyss-fixmate.cc
+index 1a169cf..36cc05b 100644
+--- a/ParseAligns/abyss-fixmate.cc
++++ b/ParseAligns/abyss-fixmate.cc
+@@ -16,6 +16,7 @@
+ #include <iterator>
+ #include <sstream>
+ #include <string>
++#include <unistd.h>
+
+ using namespace std;
+
diff --git a/sci-biology/abyss/files/abyss-1.3.6-ac_prog_ar.patch b/sci-biology/abyss/files/abyss-1.3.6-ac_prog_ar.patch
new file mode 100644
index 000000000000..158e9b1262e4
--- /dev/null
+++ b/sci-biology/abyss/files/abyss-1.3.6-ac_prog_ar.patch
@@ -0,0 +1,18 @@
+ configure.ac | 4 ++++
+ 1 file changed, 4 insertions(+)
+
+diff --git a/configure.ac b/configure.ac
+index 9d4bb66..aa94364 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -12,6 +12,10 @@ AC_PROG_CPP
+ AC_PROG_CXX
+ AC_PROG_INSTALL
+ AC_PROG_RANLIB
++AN_MAKEVAR([AR], [AC_PROG_AR])
++AN_PROGRAM([ar], [AC_PROG_AR])
++AC_DEFUN([AC_PROG_AR], [AC_CHECK_TOOL(AR, ar, :)])
++AC_PROG_AR
+ AC_CHECK_TOOL(GHC, ghc)
+ AM_CONDITIONAL([HAVE_GHC], [test "$GHC"])
+
diff --git a/sci-biology/abyss/files/abyss-1.3.6-gcc-4.7.patch b/sci-biology/abyss/files/abyss-1.3.6-gcc-4.7.patch
new file mode 100644
index 000000000000..c2cc35c31d98
--- /dev/null
+++ b/sci-biology/abyss/files/abyss-1.3.6-gcc-4.7.patch
@@ -0,0 +1,15 @@
+ ParseAligns/abyss-fixmate.cc | 1 +
+ 1 files changed, 1 insertions(+), 0 deletions(-)
+
+diff --git a/ParseAligns/abyss-fixmate.cc b/ParseAligns/abyss-fixmate.cc
+index 1a169cf..36cc05b 100644
+--- a/ParseAligns/abyss-fixmate.cc
++++ b/ParseAligns/abyss-fixmate.cc
+@@ -16,6 +16,7 @@
+ #include <iterator>
+ #include <sstream>
+ #include <string>
++#include <unistd.h>
+
+ using namespace std;
+
diff --git a/sci-biology/abyss/metadata.xml b/sci-biology/abyss/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/abyss/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/allpathslg/Manifest b/sci-biology/allpathslg/Manifest
new file mode 100644
index 000000000000..8209935b6d9e
--- /dev/null
+++ b/sci-biology/allpathslg/Manifest
@@ -0,0 +1,3 @@
+DIST allpathslg-42337.tar.gz 2739498 SHA256 a2c8f64f6ba1705b2331ca07761d189183c6745f8717ffc67ee98e9e3ca3dba6 SHA512 7595fbe14a5029578b57d16f781cbb2a0f0ad6b1af2dd770e2274f8fe2e11d0013fdff12cc85c1be748e769ffb23b7d5fe30920feef38e0e8b947d05b8bda31c WHIRLPOOL 79bda55d49877641eb55630950472a06d8f25db467dbfecde8b4d04c3ce16c071d32dd312fa9a0f72723bf4caa8f9b1d0346acf438b9671b4bed2c0672c788b9
+DIST allpathslg-47093.tar.gz 3057279 SHA256 493e21ae727250ea632b73b61545c32de2d8fb31e6a92605393ebb4af251f828 SHA512 499d23de52cad666fac663eb4a7d770b2129c4f9622f6c808ce30283429b6f67fb343f8712b07c7cb062c429117a0855da960ffc1d2ffb4e7ec2f544ba5a6314 WHIRLPOOL a3bc58dc140be3cddbd44c7035e628c4425bf86bc38592004df21d4dc91958ced9f08d667b43c15c214e53e3098805f368a856e66e5c2049b0e03d043b098ebc
+DIST allpathslg-52415.tar.gz 3129266 SHA256 3c62024a0eacdc223bc727be4718da644fb302f785c7c7347a09ff422ce96362 SHA512 afe25b07d2e07dee3ced2283ffe858f24acfb35d53e9c11fcbcc47373594453d798c344d5604eb24d5c8d3685a185a3b8807bb3547d8066cbaab8d8cf927d1d6 WHIRLPOOL de15dfeddeca2f64fd8780839c45096c28cb47ec219d781f6754f9cf65ad6dfc39b8a48aaa2c36f777282fb08ac78ef8cd04c2e1d79f4f797710d3bb38792785
diff --git a/sci-biology/allpathslg/allpathslg-42337.ebuild b/sci-biology/allpathslg/allpathslg-42337.ebuild
new file mode 100644
index 000000000000..9fb44dfcc905
--- /dev/null
+++ b/sci-biology/allpathslg/allpathslg-42337.ebuild
@@ -0,0 +1,35 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit autotools flag-o-matic
+
+DESCRIPTION="De novo assembly of whole-genome shotgun microreads"
+HOMEPAGE="http://www.broadinstitute.org/science/programs/genome-biology/crd"
+SRC_URI="ftp://ftp.broadinstitute.org/pub/crd/ALLPATHS/Release-LG/latest_source_code/${P}.tar.gz"
+
+LICENSE="MIT"
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 -x86"
+
+DEPEND="
+ dev-libs/boost
+ !sci-biology/allpaths
+ sci-biology/vaal"
+RDEPEND=""
+
+src_prepare() {
+ sed -i 's/-ggdb3//' configure.ac || die
+ eautoreconf
+}
+
+src_install() {
+ einstall || die
+ # Provided by sci-biology/vaal
+ for i in QueryLookupTable ScaffoldAccuracy MakeLookupTable Fastb ShortQueryLookup; do
+ rm "${D}/usr/bin/$i" || die
+ done
+}
diff --git a/sci-biology/allpathslg/allpathslg-47093.ebuild b/sci-biology/allpathslg/allpathslg-47093.ebuild
new file mode 100644
index 000000000000..ab971ec46c89
--- /dev/null
+++ b/sci-biology/allpathslg/allpathslg-47093.ebuild
@@ -0,0 +1,36 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit autotools eutils flag-o-matic
+
+DESCRIPTION="De novo assembly of whole-genome shotgun microreads"
+HOMEPAGE="http://www.broadinstitute.org/science/programs/genome-biology/crd"
+SRC_URI="ftp://ftp.broadinstitute.org/pub/crd/ALLPATHS/Release-LG/latest_source_code/${P}.tar.gz"
+
+LICENSE="MIT"
+SLOT="0"
+IUSE=""
+KEYWORDS="~amd64 -x86"
+
+DEPEND="
+ dev-libs/boost
+ !sci-biology/allpaths
+ sci-biology/vaal"
+RDEPEND=""
+
+src_prepare() {
+ epatch "${FILESDIR}"/${P}-gcc4.9.patch
+ sed -i 's/-ggdb//' configure.ac || die
+ eautoreconf
+}
+
+src_install() {
+ default
+ # Provided by sci-biology/vaal
+ for i in QueryLookupTable ScaffoldAccuracy MakeLookupTable Fastb ShortQueryLookup; do
+ rm "${ED}/usr/bin/$i" || die
+ done
+}
diff --git a/sci-biology/allpathslg/allpathslg-52415.ebuild b/sci-biology/allpathslg/allpathslg-52415.ebuild
new file mode 100644
index 000000000000..29de20e37670
--- /dev/null
+++ b/sci-biology/allpathslg/allpathslg-52415.ebuild
@@ -0,0 +1,54 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils flag-o-matic
+
+DESCRIPTION="De novo assembly of whole-genome shotgun microreads"
+# see also http://www.broadinstitute.org/software/allpaths-lg/blog/?page_id=12
+HOMEPAGE="http://www.broadinstitute.org/science/programs/genome-biology/crd"
+SRC_URI="ftp://ftp.broadinstitute.org/pub/crd/ALLPATHS/Release-LG/latest_source_code/${P}.tar.gz"
+
+LICENSE="MIT"
+SLOT="0"
+KEYWORDS="~amd64"
+IUSE="openmp"
+
+DEPEND="
+ dev-libs/boost
+ !sci-biology/allpaths
+ sci-biology/vaal"
+RDEPEND=""
+
+pkg_pretend() {
+ # as of release 44849, GCC 4.7.0 (or higher) is required
+ # seems pre gcc-4.7 users must stay with:
+ # ftp://ftp.broadinstitute.org/pub/crd/ALLPATHS/Release-LG/latest_source_code/2013/2013-01/allpathslg-44837.tar.gz
+ if [[ ${MERGE_TYPE} != binary ]]; then
+ [[ $(tc-getCC) == *gcc* ]] && [[ $(gcc-version) < 4.7 ]] && \
+ die "You need to use gcc >4.7"
+ fi
+}
+
+src_prepare() {
+ local i
+ sed \
+ -e 's/-ggdb//' \
+ -e 's:CEHCK:CHECK:g' \
+ -i configure.ac || die
+ for i in QueryLookupTable ScaffoldAccuracy MakeLookupTable Fastb ShortQueryLookup; do
+ sed -e "/bin_PROGRAMS/s: ${i} : :g" -i src/Makefile.am || die
+ done
+ autotools-utils_src_prepare
+}
+
+src_configure() {
+ local myeconfargs=(
+ $(use_enable openmp)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/allpathslg/files/allpathslg-47093-gcc4.9.patch b/sci-biology/allpathslg/files/allpathslg-47093-gcc4.9.patch
new file mode 100644
index 000000000000..46e5493d28ce
--- /dev/null
+++ b/sci-biology/allpathslg/files/allpathslg-47093-gcc4.9.patch
@@ -0,0 +1,16 @@
+ src/paths/long/VariantCallTools.cc | 2 +-
+ 1 file changed, 1 insertion(+), 1 deletion(-)
+
+diff --git a/src/paths/long/VariantCallTools.cc b/src/paths/long/VariantCallTools.cc
+index dfe2787..725878b 100644
+--- a/src/paths/long/VariantCallTools.cc
++++ b/src/paths/long/VariantCallTools.cc
+@@ -1674,7 +1674,7 @@ void EdgesOnRef::FindAllPathsNoLoop(const GraphT& dg, int entrace_edge, int exit
+ int n1 = to_right2[entrace_edge];
+ int n2 = to_left2[exit_edge];
+
+- PartialPath start = {{n1},{}};
++ PartialPath start{{n1},vec<int>{}};
+ stack<PartialPath> visited;
+ visited.push(start);
+ while (! visited.empty()) {
diff --git a/sci-biology/allpathslg/metadata.xml b/sci-biology/allpathslg/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/allpathslg/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/amap/Manifest b/sci-biology/amap/Manifest
new file mode 100644
index 000000000000..35e082de93b9
--- /dev/null
+++ b/sci-biology/amap/Manifest
@@ -0,0 +1 @@
+DIST amap.2.2.tar.gz 102861 RMD160 6b47b66ab5095e35bcb14a599a25687fef8e799c SHA1 618e498581302e140270a0e029ab87d378c450ef SHA256 81f8c7328c59775a5430d2210f1e4cbed7072bfd8a37f62c8d387db15b7757f4
diff --git a/sci-biology/amap/amap-2.2-r2.ebuild b/sci-biology/amap/amap-2.2-r2.ebuild
new file mode 100644
index 000000000000..389102a8e757
--- /dev/null
+++ b/sci-biology/amap/amap-2.2-r2.ebuild
@@ -0,0 +1,50 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="2"
+
+inherit eutils toolchain-funcs java-pkg-opt-2 java-ant-2
+
+MY_P=${PN}.${PV}
+
+DESCRIPTION="Protein multiple-alignment-based sequence annealing"
+HOMEPAGE="http://bio.math.berkeley.edu/amap/"
+SRC_URI="http://baboon.math.berkeley.edu/${PN}/download/${MY_P}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="java"
+
+RDEPEND="java? ( >=virtual/jre-1.5 )"
+DEPEND="java? ( >=virtual/jdk-1.5 )"
+
+S=${WORKDIR}/${PN}-align
+
+src_prepare() {
+ epatch "${FILESDIR}"/${P}-makefile.patch \
+ "${FILESDIR}"/${P}-includes.patch
+}
+
+src_compile() {
+ emake -C align CXX="$(tc-getCXX)" \
+ OPT_CXXFLAGS="${CXXFLAGS}" || die "make failed"
+
+ if use java; then
+ pushd "${S}"/display
+ eant -Ddisplay all || die
+ popd
+ fi
+}
+
+src_install() {
+ dobin align/${PN} || die
+ dodoc align/{README,PROBCONS.README} || die
+ insinto /usr/share/${PN}/examples
+ doins examples/* || die
+ if use java; then
+ java-pkg_newjar "${S}"/display/AmapDisplay.jar amapdisplay.jar
+ java-pkg_dolauncher amapdisplay --jar amapdisplay.jar
+ fi
+}
diff --git a/sci-biology/amap/files/amap-2.2-includes.patch b/sci-biology/amap/files/amap-2.2-includes.patch
new file mode 100644
index 000000000000..77c4261db5cf
--- /dev/null
+++ b/sci-biology/amap/files/amap-2.2-includes.patch
@@ -0,0 +1,44 @@
+Fixes build with gcc 4.3 and 4.6
+
+http://bugs.gentoo.org/217921
+http://bugs.gentoo.org/360517
+
+--- amap-align/align/Amap.cc
++++ amap-align/align/Amap.cc
+@@ -12,6 +12,8 @@
+ #include "ProbabilisticModel.h"
+ #include "EvolutionaryTree.h"
+ #include "SparseMatrix.h"
++#include <limits>
++#include <climits>
+ #include <string>
+ #include <sstream>
+ #include <iomanip>
+@@ -23,6 +25,7 @@
+ #include <cstdlib>
+ #include <cerrno>
+ #include <iomanip>
++#include <cstring>
+
+ string parametersInputFilename = "";
+ string parametersOutputFilename = "no training";
+--- amap-align/align/MultiSequenceDag.h
++++ amap-align/align/MultiSequenceDag.h
+@@ -13,6 +13,7 @@
+ #include <map>
+ #include <queue>
+ #include <iostream>
++#include <limits>
+ #include "MultiSequence.h"
+ #include "SparseMatrix.h"
+
+--- amap-align/align/SafeVector.h.org 2011-03-26 11:50:11.935069583 +0100
++++ amap-align/align/SafeVector.h 2011-03-26 11:50:21.112553151 +0100
+@@ -9,6 +9,7 @@
+ #define SAFEVECTOR_H
+
+ #include <cassert>
++#include <cstddef>
+ #include <vector>
+
+ /////////////////////////////////////////////////////////////////
diff --git a/sci-biology/amap/files/amap-2.2-makefile.patch b/sci-biology/amap/files/amap-2.2-makefile.patch
new file mode 100644
index 000000000000..5a9841c98255
--- /dev/null
+++ b/sci-biology/amap/files/amap-2.2-makefile.patch
@@ -0,0 +1,35 @@
+Respect {CXX,LD}FLAGS
+
+http://bugs.gentoo.org/332009
+
+--- amap-align/align/Makefile
++++ amap-align/align/Makefile
+@@ -15,6 +15,8 @@
+ # c) RELEASE mode
+ ################################################################################
+
++OPT_CXXFLAGS = -O3 -W -Wall -pedantic -funroll-loops
++
+ OTHERFLAGS = -DNumInsertStates=1 -DVERSION='"AMAP.2.2"'
+
+ # debug mode
+@@ -26,8 +28,7 @@
+
+ # release mode
+ #CXXFLAGS = -O3 -W -Wall -pedantic -DNDEBUG $(OTHERFLAGS) -mmmx -msse -msse2 -mfpmath=sse -march=pentium4 -mcpu=pentium4 -funroll-loops -fomit-frame-pointer
+-CXXFLAGS = -O3 -W -Wall -pedantic -DNDEBUG $(OTHERFLAGS) -funroll-loops
+-
++CXXFLAGS = $(OPT_CXXFLAGS) -DNDEBUG $(OTHERFLAGS)
+ ################################################################################
+ # 3) Dependencies
+ ################################################################################
+
+@@ -38,7 +37,7 @@
+ all : $(TARGETS)
+
+ amap : MultiSequenceDag.h MultiSequence.h ProbabilisticModel.h ScoreType.h Sequence.h FileBuffer.h SparseMatrix.h EvolutionaryTree.h Defaults.h SafeVector.h Amap.cc
+- $(CXX) $(CXXFLAGS) -lm -o amap Amap.cc
++ $(CXX) $(LDFLAGS) $(CXXFLAGS) -o amap Amap.cc -lm
+
+ .PHONY : clean
+ clean:
diff --git a/sci-biology/amap/metadata.xml b/sci-biology/amap/metadata.xml
new file mode 100644
index 000000000000..34294c65ca04
--- /dev/null
+++ b/sci-biology/amap/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+<herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/amos/Manifest b/sci-biology/amos/Manifest
new file mode 100644
index 000000000000..27ad50ff28ed
--- /dev/null
+++ b/sci-biology/amos/Manifest
@@ -0,0 +1 @@
+DIST amos-3.1.0.tar.gz 2094268 SHA256 2d9f50e39186ad3dde3d3b28cc265e8d632430657f40fc3978ce34ab1b3db43b SHA512 7a416b9a0438b47425355383b709491a58f38c8d834df29e43c942170e710c6ea7e3bc8c509a58421b1340ad6eece9ea2da357ce5cd1d41ce08375676ee30491 WHIRLPOOL df9b547fcc0b7bf0149641fd8df9e4558f61bb6c17ded0facfeecde25d3a6307b40414e7cb8b2f021fa8cc192ee956672c26e0fc287981f4733a393739e80b61
diff --git a/sci-biology/amos/amos-3.1.0-r1.ebuild b/sci-biology/amos/amos-3.1.0-r1.ebuild
new file mode 100644
index 000000000000..a4c860bdbe7f
--- /dev/null
+++ b/sci-biology/amos/amos-3.1.0-r1.ebuild
@@ -0,0 +1,37 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+PYTHON_COMPAT=( python2_7 )
+
+inherit eutils python-r1
+
+DESCRIPTION="A Modular, Open-Source whole genome assembler"
+HOMEPAGE="http://amos.sourceforge.net/"
+SRC_URI="mirror://sourceforge/${PN}/${P}.tar.gz"
+
+LICENSE="Artistic"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="qt4"
+
+DEPEND="qt4? ( dev-qt/qtcore:4 )"
+RDEPEND="${DEPEND}
+ dev-perl/DBI
+ dev-perl/Statistics-Descriptive
+ sci-biology/mummer"
+
+MAKEOPTS+=" -j1"
+
+src_prepare() {
+ epatch \
+ "${FILESDIR}"/${P}-gcc-4.7.patch \
+ "${FILESDIR}"/${P}-goBambus2.py-indent-and-cleanup.patch
+}
+
+src_install() {
+ default
+ python_replicate_script "${ED}"/usr/bin/goBambus2
+}
diff --git a/sci-biology/amos/amos-3.1.0.ebuild b/sci-biology/amos/amos-3.1.0.ebuild
new file mode 100644
index 000000000000..945ec9f41b4c
--- /dev/null
+++ b/sci-biology/amos/amos-3.1.0.ebuild
@@ -0,0 +1,29 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils
+
+DESCRIPTION="A Modular, Open-Source whole genome assembler"
+HOMEPAGE="http://amos.sourceforge.net/"
+SRC_URI="mirror://sourceforge/${PN}/${P}.tar.gz"
+
+LICENSE="Artistic"
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="qt4"
+
+DEPEND="qt4? ( dev-qt/qtcore:4 )"
+RDEPEND="${DEPEND}
+ dev-perl/DBI
+ dev-perl/Statistics-Descriptive
+ sci-biology/mummer"
+
+MAKEOPTS+=" -j1"
+
+src_prepare() {
+ epatch \
+ "${FILESDIR}"/${P}-gcc-4.7.patch
+}
diff --git a/sci-biology/amos/files/amos-3.1.0-gcc-4.7.patch b/sci-biology/amos/files/amos-3.1.0-gcc-4.7.patch
new file mode 100644
index 000000000000..de2a41184c52
--- /dev/null
+++ b/sci-biology/amos/files/amos-3.1.0-gcc-4.7.patch
@@ -0,0 +1,15 @@
+ src/Align/find-tandem.cc | 1 +
+ 1 files changed, 1 insertions(+), 0 deletions(-)
+
+diff --git a/src/Align/find-tandem.cc b/src/Align/find-tandem.cc
+index ddf1cab..a29e21e 100644
+--- a/src/Align/find-tandem.cc
++++ b/src/Align/find-tandem.cc
+@@ -7,6 +7,7 @@
+ #include <vector>
+ #include <ctime>
+ #include <sys/time.h>
++#include <unistd.h>
+ using namespace std;
+
+ const int OFFSET_TABLE_SIZE = 100;
diff --git a/sci-biology/amos/files/amos-3.1.0-goBambus2.py-indent-and-cleanup.patch b/sci-biology/amos/files/amos-3.1.0-goBambus2.py-indent-and-cleanup.patch
new file mode 100644
index 000000000000..97a8f59d0208
--- /dev/null
+++ b/sci-biology/amos/files/amos-3.1.0-goBambus2.py-indent-and-cleanup.patch
@@ -0,0 +1,25 @@
+--- amos-3.1.0/src/Pipeline/goBambus2.py.orig 2013-09-11 01:05:29.850090457 +0200
++++ amos-3.1.0/src/Pipeline/goBambus2.py 2013-09-11 01:07:03.250090701 +0200
+@@ -1,7 +1,7 @@
+ #pipeline script for assembly + Bambus 2
+ #contributed by Todd J Treangen
+
+-import string, sys, os, subprocess#, spincursor
++import sys, os, subprocess#, spincursor
+
+ RED = "\033[0;31m"
+ GREEN = "\033[0;32m"
+@@ -360,7 +360,7 @@
+ print "\t\t%s...failed%s"%(RED,NONE)
+ sys.exit(1)
+
+- p = subprocess.Popen(AMOSDIR+"OutputResults -b %s -prefix %s %s"%(amosbank, prefix+".scaff.linear"), shell=True, stdin=subprocess.PIPE, stdout=vtext, stderr=logfile)
++ p = subprocess.Popen(AMOSDIR+"OutputResults -b %s -prefix %s %s"%(amosbank, prefix+".scaff.linear"), shell=True, stdin=subprocess.PIPE, stdout=vtext, stderr=logfile)
+
+ if xopt_dict["verbose"] == 1:
+ print "10) running OutputResults"
+@@ -388,4 +388,3 @@
+ else:
+ print "\t\t%s...failed%s"%(RED,NONE)
+ sys.exit(1)
+-)
diff --git a/sci-biology/amos/metadata.xml b/sci-biology/amos/metadata.xml
new file mode 100644
index 000000000000..a73ee9189a98
--- /dev/null
+++ b/sci-biology/amos/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="sourceforge">amos</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/arb/Manifest b/sci-biology/arb/Manifest
new file mode 100644
index 000000000000..7ec0fa4e73a4
--- /dev/null
+++ b/sci-biology/arb/Manifest
@@ -0,0 +1,7 @@
+DIST arb-5.1-glibc2.10.patch.bz2 24659 SHA256 1153e3efe73c1027972ee1b2789ee9841749c0bd2cbb2cc3ad8cd53586ff6f2f
+DIST arb-5.1-linker.patch.bz2 4406 SHA256 62080367ebd11ed3c9991bfb872e083e2d747264a400178ab0ec11a3502f3d43
+DIST arb-5.1.tgz 9727285 SHA256 7f0a2411e7b95b94f23c51211461047eb74ffd3dd632552a82425cf903f89dbf
+DIST arb-5.2-linker.patch.bz2 4441 SHA256 3b804fca56e920f83b79f7cdfb124769bfa677a3f2216021eed04ba76ac886c6 SHA512 6afae76a4b403ad3139abd4535b5da8bbf2d16aa5f49e30c86c8f186ac585de6c789e8fa4e402576a67ce8c58468e626a46bde5cfae5869ea2c046a1492fa903 WHIRLPOOL 95435cfc7f5a530442ad294cb8cd79a666f54cc3c99195e9c05a923e41b0211e5bad7b67cd4d8c5ee37ef30de22fba4472dc8990d95aaf3c8d3edb2d3d26c984
+DIST arb-5.2.tgz 9729004 SHA256 cd68cfae317aae378da69c4c4ec8036a2babec064896d0b9d845fac2133f6edd SHA512 d1f9f7273645af7da0e949971b705303f0715ac98869acc0f75d62bfe88751709f5d5dbbc3079b0abe461ddce8262b165426e347ad28bc28a55cdf6c29b5ff56 WHIRLPOOL ec5422b4b689a77b479231c04d7b5a2f4f0ef23cd06b024920432134132d7c2c5b24c407b2561074a41606e7945ce88970789f5db82e43cc9ef9313ea48c0583
+DIST arb-5.3-linker.patch.xz 3604 SHA256 09580d0c1ff54c4956382cef850aecb9008e62e083f3246604cac72f06d05e95 SHA512 8eb072cd5a3c13b2a6ad0e40f3b155096168dbd70a6e13878d4a62e563903742442373a5e3032d6f78beefe774943fef86f6060e89acd0d18b95a7c0d4a8dec7 WHIRLPOOL f77d767c5b5c911ba3ddc9ef5b3e482cb1975b5d56f50b76166bd4a0b55e251e73eeee46709147207b2f3553d482bab99398d8bd03aef8f0b79928a8a66d0bfe
+DIST arb-5.3.tgz 9543106 SHA256 c40a3f33f39996e3e331fb41acd452e5a20b7e638b856b0b66ea8e07c977abf8 SHA512 faa924b9c6f437f77ed637798c6fe5fe5c2e6a0f2efc9c1f735133fab9c037c7039fc4ef6f6e5b0408fc39ea5c69c747b1887689f4621b608add593d77930282 WHIRLPOOL 9b4723043b4f8b9a68973f49cb7dc8c3cf3558ff646d20f7d4f20f6e4797b6c9a986fdb1dc47178f2c80251db59f61dffd1b01bbdd880f864fc749ef59e62958
diff --git a/sci-biology/arb/arb-5.1-r1.ebuild b/sci-biology/arb/arb-5.1-r1.ebuild
new file mode 100644
index 000000000000..7db2d798ec55
--- /dev/null
+++ b/sci-biology/arb/arb-5.1-r1.ebuild
@@ -0,0 +1,78 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=2
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Tools for DNA/RNA sequence database handling and data analysis, phylogenetic analysis"
+HOMEPAGE="http://www.arb-home.de/"
+SRC_URI="
+ http://download.arb-home.de/release/arb_${PV}/arbsrc.tgz -> ${P}.tgz
+ mirror://gentoo/${P}-glibc2.10.patch.bz2
+ http://dev.gentoo.org/~jlec/${P}-linker.patch.bz2"
+
+LICENSE="arb"
+SLOT="0"
+IUSE="+opengl"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ app-text/sablotron
+ media-libs/libpng
+ media-libs/tiff
+ www-client/lynx
+ x11-libs/libXaw
+ x11-libs/libXpm
+ x11-libs/motif:0
+ opengl? (
+ media-libs/glew
+ media-libs/freeglut
+ || (
+ media-libs/mesa[motif]
+ ( media-libs/mesa x11-libs/libGLw ) ) )"
+RDEPEND="${DEPEND}
+ sci-visualization/gnuplot"
+# Recommended: libmotif3 gv xfig xterm treetool java
+
+src_unpack() {
+ unpack ${A}
+ mv arbsrc* ${P}
+}
+
+src_prepare() {
+ epatch \
+ "${WORKDIR}"/${P}-glibc2.10.patch\
+ "${WORKDIR}"/${P}-linker.patch \
+ "${FILESDIR}"/${PV}-libs.patch \
+ "${FILESDIR}"/${PV}-bfr-overflow.patch
+ sed -i \
+ -e 's/all: checks/all:/' \
+ -e "s/GCC:=.*/GCC=$(tc-getCC) ${CFLAGS}/" \
+ -e "s/GPP:=.*/GPP=$(tc-getCXX) ${CXXFLAGS}/" \
+ -e 's/--export-dynamic/-Wl,--export-dynamic/g' \
+ "${S}/Makefile" || die
+ cp config.makefile.template config.makefile
+ sed -i -e '/^[ \t]*read/ d' -e 's/SHELL_ANS=0/SHELL_ANS=1/' "${S}/arb_install.sh" || die
+ use amd64 && sed -i -e 's/ARB_64 := 0/ARB_64 := 1/' config.makefile
+ use opengl || sed -i -e 's/OPENGL := 1/OPENGL := 0/' config.makefile
+ emake ARBHOME="${S}" links || die
+}
+
+src_compile() {
+ emake ARBHOME="${S}" PATH="${PATH}:${S}/bin" LD_LIBRARY_PATH="${LD_LIBRARY_PATH}:${S}/lib" tarfile || die
+ use amd64 && mv arb.tgz arb.64.gentoo.tgz
+ use x86 && mv arb.tgz arb.32.gentoo.tgz
+ ln -s arb.*.tgz arb.tgz || die
+}
+
+src_install() {
+ ARBHOME="${D}/opt/arb" "${S}/arb_install.sh" || die
+ cat <<- EOF > "${S}/99${PN}"
+ ARBHOME=/opt/arb
+ PATH=/opt/arb/bin
+ LD_LIBRARY_PATH=/opt/arb/lib
+ EOF
+ doenvd "${S}/99${PN}" || die
+}
diff --git a/sci-biology/arb/arb-5.2.ebuild b/sci-biology/arb/arb-5.2.ebuild
new file mode 100644
index 000000000000..97f7dc5dfbdd
--- /dev/null
+++ b/sci-biology/arb/arb-5.2.ebuild
@@ -0,0 +1,80 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Tools for DNA/RNA sequence database handling and data analysis, phylogenetic analysis"
+HOMEPAGE="http://www.arb-home.de/"
+SRC_URI="
+ http://download.arb-home.de/release/arb_${PV}/arbsrc.tgz -> ${P}.tgz
+ http://dev.gentoo.org/~jlec/distfiles/${P}-linker.patch.bz2"
+
+SLOT="0"
+LICENSE="arb"
+IUSE="+opengl"
+KEYWORDS="~amd64 ~x86"
+
+CDEPEND="app-text/sablotron
+ media-libs/libpng
+ media-libs/tiff
+ www-client/lynx
+ x11-libs/libXaw
+ x11-libs/libXpm
+ x11-libs/motif:0
+ opengl? (
+ media-libs/glew
+ media-libs/freeglut
+ || (
+ media-libs/mesa[motif]
+ ( media-libs/mesa x11-libs/libGLw ) ) )"
+DEPEND="${CDEPEND}
+ sys-process/time"
+RDEPEND="${CDEPEND}
+ sci-visualization/gnuplot"
+# Recommended: libmotif3 gv xfig xterm treetool java
+
+src_unpack() {
+ unpack ${A}
+ mv arbsrc* ${P}
+}
+
+src_prepare() {
+ epatch \
+ "${WORKDIR}"/${P}-linker.patch \
+ "${FILESDIR}"/5.1-libs.patch \
+ "${FILESDIR}"/5.1-bfr-overflow.patch \
+ "${FILESDIR}"/${PV}-libpng15.patch \
+ "${FILESDIR}"/${P}-gcc-47.patch
+ sed \
+ -e 's/all: checks/all:/' \
+ -e "s/GCC:=.*/GCC=$(tc-getCC) ${CFLAGS}/" \
+ -e "s/GPP:=.*/GPP=$(tc-getCXX) ${CXXFLAGS}/" \
+ -e 's:-O4::g' \
+ -e 's:-pipe::g' \
+ -i "${S}/Makefile" || die
+ cp config.makefile.template config.makefile
+ sed -i -e '/^[ \t]*read/ d' -e 's/SHELL_ANS=0/SHELL_ANS=1/' "${S}/arb_install.sh" || die
+ use amd64 && sed -i -e 's/ARB_64 := 0/ARB_64 := 1/' config.makefile
+ use opengl || sed -i -e 's/OPENGL := 1/OPENGL := 0/' config.makefile
+ emake ARBHOME="${S}" links
+}
+
+src_compile() {
+ emake ARBHOME="${S}" PATH="${PATH}:${S}/bin" LD_LIBRARY_PATH="${LD_LIBRARY_PATH}:${S}/lib" tarfile
+ use amd64 && mv arb.tgz arb.64.gentoo.tgz
+ use x86 && mv arb.tgz arb.32.gentoo.tgz
+ ln -s arb.*.tgz arb.tgz || die
+}
+
+src_install() {
+ ARBHOME="${D}/opt/arb" "${S}/arb_install.sh" || die
+ cat <<- EOF > "${S}/99${PN}"
+ ARBHOME=/opt/arb
+ PATH=/opt/arb/bin
+ LD_LIBRARY_PATH=/opt/arb/lib
+ EOF
+ doenvd "${S}/99${PN}"
+}
diff --git a/sci-biology/arb/arb-5.3.ebuild b/sci-biology/arb/arb-5.3.ebuild
new file mode 100644
index 000000000000..97f8b78ddca2
--- /dev/null
+++ b/sci-biology/arb/arb-5.3.ebuild
@@ -0,0 +1,78 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Tools for DNA/RNA sequence database handling and data analysis, phylogenetic analysis"
+HOMEPAGE="http://www.arb-home.de/"
+SRC_URI="
+ http://download.arb-home.de/release/arb_${PV}/arbsrc.tgz -> ${P}.tgz
+ http://dev.gentoo.org/~jlec/distfiles/${P}-linker.patch.xz"
+
+SLOT="0"
+LICENSE="arb"
+IUSE="+opengl"
+KEYWORDS="~amd64 ~x86"
+
+CDEPEND="app-text/sablotron
+ media-libs/libpng
+ media-libs/tiff
+ www-client/lynx
+ x11-libs/libXaw
+ x11-libs/libXpm
+ x11-libs/motif:0
+ opengl? (
+ media-libs/glew
+ media-libs/freeglut
+ || (
+ media-libs/mesa[motif]
+ ( media-libs/mesa x11-libs/libGLw ) ) )"
+DEPEND="${CDEPEND}
+ sys-process/time"
+RDEPEND="${CDEPEND}
+ sci-visualization/gnuplot"
+# Recommended: libmotif3 gv xfig xterm treetool java
+
+src_unpack() {
+ unpack ${A}
+ mv arbsrc* ${P}
+}
+
+src_prepare() {
+ epatch \
+ "${WORKDIR}"/${P}-linker.patch \
+ "${FILESDIR}"/5.1-libs.patch \
+ "${FILESDIR}"/5.1-bfr-overflow.patch \
+ "${FILESDIR}"/5.2-libpng15.patch \
+ "${FILESDIR}"/${PN}-5.2-gcc-47.patch
+ sed \
+ -e 's/all: checks/all:/' \
+ -e "s/GCC:=.*/GCC=$(tc-getCC) ${CFLAGS}/" \
+ -e "s/GPP:=.*/GPP=$(tc-getCXX) ${CXXFLAGS}/" \
+ -i "${S}/Makefile" || die
+ cp config.makefile.template config.makefile
+ sed -i -e '/^[ \t]*read/ d' -e 's/SHELL_ANS=0/SHELL_ANS=1/' "${S}/arb_install.sh" || die
+ use amd64 && sed -i -e 's/ARB_64 := 0/ARB_64 := 1/' config.makefile
+ use opengl || sed -i -e 's/OPENGL := 1/OPENGL := 0/' config.makefile
+ emake ARBHOME="${S}" links
+}
+
+src_compile() {
+ emake ARBHOME="${S}" PATH="${PATH}:${S}/bin" LD_LIBRARY_PATH="${LD_LIBRARY_PATH}:${S}/lib" tarfile
+ use amd64 && mv arb.tgz arb.64.gentoo.tgz
+ use x86 && mv arb.tgz arb.32.gentoo.tgz
+ ln -s arb.*.tgz arb.tgz || die
+}
+
+src_install() {
+ ARBHOME="${D}/opt/arb" "${S}/arb_install.sh" || die
+ cat <<- EOF > "${S}/99${PN}"
+ ARBHOME=/opt/arb
+ PATH=/opt/arb/bin
+ LD_LIBRARY_PATH=/opt/arb/lib
+ EOF
+ doenvd "${S}/99${PN}"
+}
diff --git a/sci-biology/arb/files/5.1-bfr-overflow.patch b/sci-biology/arb/files/5.1-bfr-overflow.patch
new file mode 100644
index 000000000000..21d21f5ac17f
--- /dev/null
+++ b/sci-biology/arb/files/5.1-bfr-overflow.patch
@@ -0,0 +1,16 @@
+ ARB_GDE/GDE_HGLfile.cxx | 2 +-
+ 1 files changed, 1 insertions(+), 1 deletions(-)
+
+diff --git a/ARB_GDE/GDE_HGLfile.cxx b/ARB_GDE/GDE_HGLfile.cxx
+index e353a89..f69635a 100644
+--- a/ARB_GDE/GDE_HGLfile.cxx
++++ b/ARB_GDE/GDE_HGLfile.cxx
+@@ -494,7 +494,7 @@ void ReadGDE(char *filename,NA_Alignment *dataset,int type)
+ if(this_elem->id[0] == '\0')
+ strncpy(this_elem->id,uniqueID(),79);
+ if(this_elem->short_name[0] == '\0')
+- strncpy(this_elem->short_name,this_elem->id,79);
++ strncpy(this_elem->short_name,this_elem->id,31);
+ if(this_elem->seqlen == 0)
+ this_elem->protect=
+ PROT_BASE_CHANGES+
diff --git a/sci-biology/arb/files/5.1-libs.patch b/sci-biology/arb/files/5.1-libs.patch
new file mode 100644
index 000000000000..bf0bacad3286
--- /dev/null
+++ b/sci-biology/arb/files/5.1-libs.patch
@@ -0,0 +1,16 @@
+diff --git a/SOURCE_TOOLS/provide_libs.pl b/SOURCE_TOOLS/provide_libs.pl
+index b653a66..b346c96 100644
+--- a/SOURCE_TOOLS/provide_libs.pl
++++ b/SOURCE_TOOLS/provide_libs.pl
+@@ -118,11 +118,6 @@ sub provide_libs($$$) {
+ foreach my $lib (keys %needed_by) {
+ update_lib($lib, $bindir.'/'.$needed_by{$lib}, $addlibsdir);
+ }
+- if ($opengl==1) {
+- foreach my $lib (keys %needed_by_opengl) {
+- update_lib($lib, $bindir.'/'.$needed_by_opengl{$lib}, $addlibsdir);
+- }
+- }
+ }
+
+ sub main() {
diff --git a/sci-biology/arb/files/5.2-libpng15.patch b/sci-biology/arb/files/5.2-libpng15.patch
new file mode 100644
index 000000000000..3d750e76efe3
--- /dev/null
+++ b/sci-biology/arb/files/5.2-libpng15.patch
@@ -0,0 +1,45 @@
+Fix building with libpng-1.5
+
+https://bugs.gentoo.org/show_bug.cgi?id=378353
+
+Patch written by Samuli Suominen <ssuominen@gentoo.org>
+--- a/GL/glpng/glpng.c
++++ b/GL/glpng/glpng.c
+@@ -285,7 +285,7 @@
+ endinfo = png_create_info_struct(png);
+
+ // DH: added following lines
+- if (setjmp(png->jmpbuf))
++ if (setjmp(png_jmpbuf(png)))
+ {
+ png_destroy_read_struct(&png, &info, &endinfo);
+ return 0;
+@@ -390,7 +390,7 @@
+ endinfo = png_create_info_struct(png);
+
+ // DH: added following lines
+- if (setjmp(png->jmpbuf))
++ if (setjmp(png_jmpbuf(png)))
+ {
+ png_destroy_read_struct(&png, &info, &endinfo);
+ return 0;
+@@ -569,7 +569,7 @@
+ #define ALPHA *q
+
+ switch (trans) {
+- case PNG_CALLBACK:
++ case PNG_CALLBACKT:
+ FORSTART
+ ALPHA = AlphaCallback((unsigned char) r, (unsigned char) g, (unsigned char) b);
+ FOREND
+--- a/GL/glpng/glpng.h
++++ b/GL/glpng/glpng.h
+@@ -57,7 +57,7 @@
+ #define PNG_SIMPLEMIPMAP PNG_SIMPLEMIPMAPS
+
+ /* Transparency parameters */
+-#define PNG_CALLBACK -3 /* Call the callback function to generate alpha */
++#define PNG_CALLBACKT -3 /* Call the callback function to generate alpha */
+ #define PNG_ALPHA -2 /* Use alpha channel in PNG file, if there is one */
+ #define PNG_SOLID -1 /* No transparency */
+ #define PNG_STENCIL 0 /* Sets alpha to 0 for r=g=b=0, 1 otherwise */
diff --git a/sci-biology/arb/files/arb-5.2-gcc-47.patch b/sci-biology/arb/files/arb-5.2-gcc-47.patch
new file mode 100644
index 000000000000..186e78e450b3
--- /dev/null
+++ b/sci-biology/arb/files/arb-5.2-gcc-47.patch
@@ -0,0 +1,15 @@
+ AWTI/AWTI_import.cxx | 1 +
+ 1 files changed, 1 insertions(+), 0 deletions(-)
+
+diff --git a/AWTI/AWTI_import.cxx b/AWTI/AWTI_import.cxx
+index 8e730ac..e3f9ff4 100644
+--- a/AWTI/AWTI_import.cxx
++++ b/AWTI/AWTI_import.cxx
+@@ -12,6 +12,7 @@
+ #include <GEN.hxx>
+
+ #include <climits>
++#include <unistd.h>
+
+ using namespace std;
+
diff --git a/sci-biology/arb/metadata.xml b/sci-biology/arb/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/arb/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/ariadne/Manifest b/sci-biology/ariadne/Manifest
new file mode 100644
index 000000000000..a4bf86d55d3c
--- /dev/null
+++ b/sci-biology/ariadne/Manifest
@@ -0,0 +1 @@
+DIST ariadne-1.3.tar.Z 69427 SHA256 8b6b0acb6e8d02b1303d94b20906bf2bf1dee3de4eceeb1b927cfba7a96fd00d SHA512 6c803f945bbcf36c08407e907ad716dc7cd01c7bed555777af46a5dc626b56ca3d1de7d16cab82bfa8bd5a91e06f42c590c0489594251405999459459e9c7289 WHIRLPOOL 460d8acf2bb49e097a9544ecc089ca60c3478b64ab4d903bd6ee801eccd62fc560bdccf1454c9f22632081cbf1df35de09a4f81d6c131d3f52f36753bc692927
diff --git a/sci-biology/ariadne/ariadne-1.3-r1.ebuild b/sci-biology/ariadne/ariadne-1.3-r1.ebuild
new file mode 100644
index 000000000000..80a05b612ca9
--- /dev/null
+++ b/sci-biology/ariadne/ariadne-1.3-r1.ebuild
@@ -0,0 +1,38 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+inherit toolchain-funcs eutils
+
+DESCRIPTION="Protein sequences and profiles comparison"
+
+HOMEPAGE="http://www.well.ox.ac.uk/ariadne/"
+SRC_URI="http://www.well.ox.ac.uk/${PN}/${P}.tar.Z"
+
+LICENSE="ARIADNE"
+SLOT="0"
+KEYWORDS="~amd64 x86"
+IUSE=""
+
+DEPEND=">=sci-biology/ncbi-tools-0.20041020-r1"
+RDEPEND="${DEPEND}"
+
+S="${WORKDIR}/SRC-${PV}"
+
+src_unpack(){
+ unpack ${A}
+ cd "${S}"
+ epatch "${FILESDIR}"/${P}-gcc4.patch
+ sed -e "s/CC = gcc/CC = $(tc-getCC)/" \
+ -e "s/OPTIMISE = -O2/OPTIMISE = ${CFLAGS}/" \
+ -i Makefile || die
+ sed -e "s/blosum62/BLOSUM62/" -i prospero.c || die
+}
+
+src_install() {
+ dobin Linux/{ariadne,prospero} || die
+ dolib Linux/libseq.a || die
+ insinto /usr/include/${PN}
+ doins Include/*.h || die
+ dodoc README || die
+}
diff --git a/sci-biology/ariadne/ariadne-1.3-r2.ebuild b/sci-biology/ariadne/ariadne-1.3-r2.ebuild
new file mode 100644
index 000000000000..1fa55ce322db
--- /dev/null
+++ b/sci-biology/ariadne/ariadne-1.3-r2.ebuild
@@ -0,0 +1,40 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Protein sequences and profiles comparison"
+HOMEPAGE="http://www.well.ox.ac.uk/ariadne/"
+SRC_URI="http://www.well.ox.ac.uk/${PN}/${P}.tar.Z"
+
+LICENSE="ARIADNE"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="static-libs"
+
+DEPEND=">=sci-biology/ncbi-tools-0.20041020-r1"
+RDEPEND="${DEPEND}"
+
+S=${WORKDIR}/SRC-${PV}
+
+src_prepare() {
+ epatch "${FILESDIR}"/${P}-gcc4.patch \
+ "${FILESDIR}"/${P}-implicits.patch
+ sed -i -e "s/\$(CFLAGS)/\$(LDFLAGS) &/" Makefile || die #359045
+ sed -e "s/blosum62/BLOSUM62/" -i prospero.c || die
+}
+
+src_compile() {
+ emake CC="$(tc-getCC)" OPTIMISE="${CFLAGS}"
+}
+
+src_install() {
+ dobin Linux/{ariadne,prospero}
+ use static-libs && dolib.a Linux/libseq.a
+ insinto /usr/include/${PN}
+ doins Include/*.h || die
+ dodoc README || die
+}
diff --git a/sci-biology/ariadne/files/ariadne-1.3-gcc4.patch b/sci-biology/ariadne/files/ariadne-1.3-gcc4.patch
new file mode 100644
index 000000000000..0192efd4db5e
--- /dev/null
+++ b/sci-biology/ariadne/files/ariadne-1.3-gcc4.patch
@@ -0,0 +1,10 @@
+--- cl.c.old 2006-09-12 17:13:02.000000000 -0400
++++ cl.c 2006-09-12 17:13:34.000000000 -0400
+@@ -658,6 +658,7 @@
+ fclose(fp);
+ if ( ! stat( filename, &buf ) )
+ {
++ char *ctime(), *t;
+ sprintf( date, "%s", ctime(&buf.st_mtime) );
+ t = date;
+ while ( *t )
diff --git a/sci-biology/ariadne/files/ariadne-1.3-implicits.patch b/sci-biology/ariadne/files/ariadne-1.3-implicits.patch
new file mode 100644
index 000000000000..31c442b12265
--- /dev/null
+++ b/sci-biology/ariadne/files/ariadne-1.3-implicits.patch
@@ -0,0 +1,23 @@
+topalign.c:96:5: warning: implicit declaration of function ‘toupper’
+prospero.c:63:3: warning: implicit declaration of function ‘strcpy’
+
+--- SRC-1.3/prospero.c
++++ SRC-1.3/prospero.c
+@@ -26,6 +26,7 @@
+ */
+
+ #include<stdio.h>
++#include<string.h>
+ #include<math.h>
+ #include"cl.h"
+ #include"seq_util.h"
+--- SRC-1.3/topalign.c
++++ SRC-1.3/topalign.c
+@@ -26,6 +26,7 @@
+ */
+
+ #include<stdio.h>
++#include<ctype.h>
+ #include<math.h>
+ #include"seq_util.h"
+ #include"ariadne.h"
diff --git a/sci-biology/ariadne/metadata.xml b/sci-biology/ariadne/metadata.xml
new file mode 100644
index 000000000000..3e55c00f9d7b
--- /dev/null
+++ b/sci-biology/ariadne/metadata.xml
@@ -0,0 +1,17 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <longdescription>
+ ARIADNE is a package of two programs, ariadne and prospero, that
+ compare protein sequences and profiles using the Smith-Waterman
+ algorithm, and assesses statistical significance using a new accurate
+ formula, described in Mott, 2000, "Accurate Formula for P-values of
+ gapped local sequence and profile alignments" J. Mol Biol. 300:649-659.
+ The sequence/profile comparison algorithms used in ARIADNE are
+ standard, and are probably not the fastest implementations available.
+ The novel part is the method for determining statistical significance,
+ which will give thresholds of significance that are accurate to within
+ 5% 95% of the time.
+ </longdescription>
+</pkgmetadata>
diff --git a/sci-biology/augustus/Manifest b/sci-biology/augustus/Manifest
new file mode 100644
index 000000000000..cdfb577937e0
--- /dev/null
+++ b/sci-biology/augustus/Manifest
@@ -0,0 +1 @@
+DIST augustus.2.5.5.tar.gz 70826249 SHA256 2bd97784fa651addf836e2100a7d4106b43e50fe06f13c664001d4625d0eab9a SHA512 33eb05d5c90200d2fc17026743d3a25e73aa3e217b8546f0bed4c94bcb460597d853377a67896e52e45ead5d736d13ed3b2c91b31fed8216da2920c825e8c20f WHIRLPOOL 875f56f10251767fb066b5e21b0c2361c952d5cc44daa811658be8119957ffa34fd4552fde7e17384d5bc916aee5ef91982ded3999d0077cf3834d5fc20e7f1a
diff --git a/sci-biology/augustus/augustus-2.5.5.ebuild b/sci-biology/augustus/augustus-2.5.5.ebuild
new file mode 100644
index 000000000000..e58be6db6d6a
--- /dev/null
+++ b/sci-biology/augustus/augustus-2.5.5.ebuild
@@ -0,0 +1,50 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Eukaryotic gene predictor"
+HOMEPAGE="http://augustus.gobics.de/"
+SRC_URI="http://augustus.gobics.de/binaries/${PN}.${PV}.tar.gz"
+
+LICENSE="Artistic"
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="examples"
+
+S="${WORKDIR}/${PN}.${PV}"
+
+src_prepare() {
+ epatch "${FILESDIR}"/${P}-sane-build.patch
+ tc-export CC CXX
+}
+
+src_compile() {
+ emake clean && emake
+}
+
+src_install() {
+ dobin bin/*
+# dobin src/{augustus,etraining,consensusFinder,curve2hints,fastBlockSearch,prepareAlign}
+
+ exeinto /usr/libexec/${PN}
+ doexe scripts/*.p*
+ insinto /usr/libexec/${PN}
+ doins scripts/*.conf
+
+ insinto /usr/share/${PN}
+ doins -r config
+
+ echo "AUGUSTUS_CONFIG_PATH=\"/usr/share/${PN}/config\"" > "${S}/99${PN}"
+ doenvd "${S}/99${PN}"
+
+ dodoc -r README.TXT HISTORY.TXT docs/*.{pdf,txt}
+
+ if use examples; then
+ insinto /usr/share/${PN}/
+ doins -r docs/tutorial examples
+ fi
+}
diff --git a/sci-biology/augustus/files/augustus-2.5.5-sane-build.patch b/sci-biology/augustus/files/augustus-2.5.5-sane-build.patch
new file mode 100644
index 000000000000..39cd0762b1c1
--- /dev/null
+++ b/sci-biology/augustus/files/augustus-2.5.5-sane-build.patch
@@ -0,0 +1,156 @@
+ Makefile | 8 +++---
+ scripts/Makefile | 6 +++-
+ scripts/aln2wig/Makefile | 8 +++---
+ scripts/compileSpliceCands/Makefile | 6 ++--
+ src/Makefile | 43 ++++++++++++++++++----------------
+ 5 files changed, 38 insertions(+), 33 deletions(-)
+
+diff --git a/Makefile b/Makefile
+index e23a667..64610c8 100644
+--- a/Makefile
++++ b/Makefile
+@@ -3,9 +3,9 @@
+ #
+
+ all:
+- cd src && ${MAKE}
+- cd scripts && ${MAKE}
++ $(MAKE) -C src
++ $(MAKE) -C scripts
+
+ clean:
+- cd src && ${MAKE} clean
+- cd scripts && ${MAKE} clean
++ $(MAKE) -C src clean
++ $(MAKE) -C scripts clean
+diff --git a/scripts/Makefile b/scripts/Makefile
+index 6d4dd67..ab6a885 100644
+--- a/scripts/Makefile
++++ b/scripts/Makefile
+@@ -1,5 +1,7 @@
+ all :
+- cd aln2wig && ${MAKE}
++ $(MAKE) -C aln2wig
++ $(MAKE) -C compileSpliceCands
+
+ clean :
+- cd aln2wig && ${MAKE} clean
++ $(MAKE) -C aln2wig clean
++ $(MAKE) -C compileSpliceCands
+diff --git a/scripts/aln2wig/Makefile b/scripts/aln2wig/Makefile
+index 64d09f5..9752980 100644
+--- a/scripts/aln2wig/Makefile
++++ b/scripts/aln2wig/Makefile
+@@ -1,10 +1,10 @@
+-CFLAGS := -Wall -Wno-unused-result -Wno-sign-compare -ansi -pedantic -O2 -ggdb
++CFLAGS += -Wall -Wno-unused-result -Wno-sign-compare -ansi -pedantic
+
+ psl2wig : aln2wig.o
+- gcc $(CFLAGS) -o aln2wig aln2wig.o;
+- cp aln2wig ../../bin
++ $(CC) $(CFLAGS) $(LDFLAGS) -o aln2wig aln2wig.o;
++ cp aln2wig ../../bin/
+ psl2wig.o : aln2wig.c
+- gcc $(CFLAGS) -c aln2wig.c
++ $(CC) $(CFLAGS) -c aln2wig.c
+
+ all : psl2wig
+
+diff --git a/scripts/compileSpliceCands/Makefile b/scripts/compileSpliceCands/Makefile
+index cddada5..8079791 100644
+--- a/scripts/compileSpliceCands/Makefile
++++ b/scripts/compileSpliceCands/Makefile
+@@ -1,8 +1,8 @@
+ compileSpliceCands : compileSpliceCands.o list.h list.o
+- gcc -o compileSpliceCands compileSpliceCands.o list.o;
+-# cp compileSpliceCands ../../bin
++ $(CC) $(CFLAGS) $(LDFLAGS) -o compileSpliceCands compileSpliceCands.o list.o;
++ cp compileSpliceCands ../../bin/
+ compileSpliceCands.o : compileSpliceCands.c
+- gcc -Wall -pedantic -ansi -c compileSpliceCands.c
++ $(CC) $(CFLAGS) -Wall -pedantic -ansi -c compileSpliceCands.c
+
+ all : compileSpliceCands
+
+diff --git a/src/Makefile b/src/Makefile
+index 71795b6..732b953 100644
+--- a/src/Makefile
++++ b/src/Makefile
+@@ -6,8 +6,8 @@
+ # a strict signed-only usage strategy to avoid mistakes since we are not warned about this.
+ # - In the current version, the order of object files in $(OBJS) IS IMPORTANT (see lldouble.hh)
+ #
+-CC = g++
+-CFLAGS := -Wall -Wno-sign-compare -ansi -pedantic -O2 ${CFLAGS} -static # -pg -DDEBUG -g -ggdb -static
++CXX ?= g++
++CXXFLAGS += -Wall -Wno-sign-compare -ansi -pedantic # -pg -DDEBUG -g -ggdb -static
+ INCLS = -I../include -I.
+ LIBS = # -lcwd
+ OBJS = genbank.o properties.o pp_profile.o pp_hitseq.o pp_scoring.o statemodel.o namgene.o \
+@@ -18,45 +18,48 @@ TOBJS = commontrain.o igenictrain.o introntrain.o exontrain.o utrtrain.o # conte
+ PROGR = augustus etraining consensusFinder curve2hints fastBlockSearch prepareAlign
+ INFO = cflags
+
+-all: $(OBJS) $(TOBJS) $(DUMOBJS) $(PROGR) info
++all: $(OBJS) $(TOBJS) $(DUMOBJS) $(PROGR) info bin
+
+ .SUFFIXES:
+ .SUFFIXES: .cc .o .so
+
+ .cc.o:
+- $(CC) -c $(CFLAGS) -o $@ $< $(INCLS)
++ $(CXX) -c $(CXXFLAGS) -o $@ $< $(INCLS)
+
+-augustus: augustus.cc $(OBJS) $(DUMOBJS)
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++bin: $(PROGR)
++ cp $(PROGR) ../bin/
++
++augustus: augustus.o $(OBJS) $(DUMOBJS)
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+ cp augustus ../bin/
+
+-etraining: etraining.cc $(TOBJS) $(OBJS)
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++etraining: etraining.o $(TOBJS) $(OBJS)
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+ cp etraining ../bin/
+
+-evaluate: evaluate.cc $(OBJS) $(DUMOBJS)
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++evaluate: evaluate.o $(OBJS) $(DUMOBJS)
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+
+-consensusFinder: consensusFinder.cc consensus.o
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++consensusFinder: consensusFinder.o consensus.o
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+
+-curve2hints: curve2hints.cc exon_seg.o
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++curve2hints: curve2hints.o exon_seg.o
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+
+-fastBlockSearch: fastBlockSearch.cc pp_fastBlockSearcher.o \
++fastBlockSearch: fastBlockSearch.o pp_fastBlockSearcher.o \
+ types.o properties.o geneticcode.o pp_profile.o lldouble.o
+- $(CC) $(CFLAGS) -o $@ $^ $(INCLS) $(LIBS)
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+ cp fastBlockSearch ../bin/
+
+-prepareAlign: pp_prepare_align.cc
+- $(CC) $(CFLAGS) -o $@ $^
++prepareAlign: pp_prepare_align.o
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) -o $@ $^
+ cp prepareAlign ../bin/
+
+ info:
+- echo "$(CFLAGS)" > $(INFO)
++ echo "$(CXXFLAGS)" > $(INFO)
+
+ clean:
+- rm -f $(PROGR) $(OBJS) $(DUMOBJS) $(TOBJS) consensus.o exon_seg.o pp_fastBlockSearcher.o $(INFO)
++ rm -f $(PROGR) $(OBJS) $(DUMOBJS) $(TOBJS) consensus.o exon_seg.o pp_fastBlockSearcher.o $(INFO) ../bin/*
+
+ tidy: clean
+ rm -f *~ *.o *.rej *.orig ../include/*~ ../include/*.orig ../include/*.rej $(INFO)
diff --git a/sci-biology/augustus/metadata.xml b/sci-biology/augustus/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/augustus/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/bamtools/Manifest b/sci-biology/bamtools/Manifest
new file mode 100644
index 000000000000..1c1972c599d5
--- /dev/null
+++ b/sci-biology/bamtools/Manifest
@@ -0,0 +1,2 @@
+DIST bamtools-1.0.2.tar.gz 207523 SHA256 d3ca75d2bec531f15dbc400a76afbe48d47452ce05552c88943bbce81a0862d8 SHA512 1934d40d50f3fdf2b1fcacb8b59cf954a3c791d3095649ac4f1246563e9d8d4afe385e42a2c6c383f0bb519eede401d12c71203d279b33e01575222f9f84c244 WHIRLPOOL 9fb4d4feb3ff867866a96533231a1b8284fd5156ab142cad727d32f8f3c157e246cca59185c3bdc253b19bde2514404a7107a62443780b060f6e8f270622c990
+DIST bamtools-2.3.0.tar.gz 539446 SHA256 288046e6d5d41afdc5fce8608c5641cf2b8e670644587c1315b90bbe92f039af SHA512 432f66384cffc04ab6bc7dc66d8f7b79c1e468d0068db4cabb5cac05f9b6bef7968eff71ffb3ee51b84e23d9bb66a11ef267024138f40116c25e7f18e7210a5c WHIRLPOOL dd888f67c3d0b0ce2f5f2875e242e5df0d54cefd13693230b5f10eb57dd780304b601027cf65f6598a54061a7166903bf06c6c9a46939f6ce6bbb246cab89993
diff --git a/sci-biology/bamtools/bamtools-1.0.2.ebuild b/sci-biology/bamtools/bamtools-1.0.2.ebuild
new file mode 100644
index 000000000000..08c40d0705d3
--- /dev/null
+++ b/sci-biology/bamtools/bamtools-1.0.2.ebuild
@@ -0,0 +1,33 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit cmake-utils
+
+DESCRIPTION="A programmer's API and an end-user's toolkit for handling BAM files"
+HOMEPAGE="https://github.com/pezmaster31/bamtools"
+SRC_URI="mirror://github/pezmaster31/bamtools/"${P}".tar.gz"
+
+LICENSE="MIT"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+DEPEND="sys-libs/zlib"
+RDEPEND="${DEPEND}"
+
+src_install() {
+ for i in bin/bamtools-${PV} lib/libbamtools.so.${PV} lib/libbamtools-utils.so.${PV}; do
+ TMPDIR="$(pwd)" scanelf -Xr $i || die
+ done
+
+ dobin bin/bamtools
+ dolib lib/*
+ insinto /usr/include/bamtools/api
+ doins include/api/*
+ insinto /usr/include/bamtools/shared
+ doins include/shared/*
+ dodoc README
+}
diff --git a/sci-biology/bamtools/bamtools-2.3.0.ebuild b/sci-biology/bamtools/bamtools-2.3.0.ebuild
new file mode 100644
index 000000000000..cb86750cc0cf
--- /dev/null
+++ b/sci-biology/bamtools/bamtools-2.3.0.ebuild
@@ -0,0 +1,28 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit cmake-utils
+
+DESCRIPTION="A programmer's API and an end-user's toolkit for handling BAM files"
+HOMEPAGE="https://github.com/pezmaster31/bamtools"
+SRC_URI="https://github.com/pezmaster31/${PN}/archive/v${PV}.tar.gz -> ${P}.tar.gz"
+
+LICENSE="MIT"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="static-libs"
+
+DEPEND="
+ >=dev-libs/jsoncpp-0.5.0-r1
+ sys-libs/zlib"
+RDEPEND="${DEPEND}"
+
+PATCHES=( "${FILESDIR}"/${P}-unbundle.patch )
+
+src_install() {
+ cmake-utils_src_install
+ use static-libs || rm "${ED}"/usr/$(get_libdir)/*.a
+}
diff --git a/sci-biology/bamtools/files/bamtools-2.2.3-unbundle.patch b/sci-biology/bamtools/files/bamtools-2.2.3-unbundle.patch
new file mode 100644
index 000000000000..318396e75c36
--- /dev/null
+++ b/sci-biology/bamtools/files/bamtools-2.2.3-unbundle.patch
@@ -0,0 +1,32 @@
+ src/CMakeLists.txt | 1 -
+ src/api/CMakeLists.txt | 4 ++--
+ src/toolkit/bamtools_filter.cpp | 2 +-
+ 3 files changed, 3 insertions(+), 4 deletions(-)
+
+diff --git a/src/CMakeLists.txt b/src/CMakeLists.txt
+index e359695..2bd2185 100644
+--- a/src/CMakeLists.txt
++++ b/src/CMakeLists.txt
+@@ -6,7 +6,6 @@
+ # ==========================
+
+ add_subdirectory( api )
+-add_subdirectory( third_party )
+ add_subdirectory( toolkit )
+ add_subdirectory( utils )
+
+diff --git a/src/api/CMakeLists.txt b/src/api/CMakeLists.txt
+index 66eb35f..65f4639 100644
+--- a/src/api/CMakeLists.txt
++++ b/src/api/CMakeLists.txt
+@@ -54,8 +54,8 @@ target_link_libraries( BamTools ${APILibs} )
+ target_link_libraries( BamTools-static ${APILibs} )
+
+ # set library install destinations
+-install( TARGETS BamTools LIBRARY DESTINATION "lib/bamtools" RUNTIME DESTINATION "bin")
+-install( TARGETS BamTools-static ARCHIVE DESTINATION "lib/bamtools")
++install( TARGETS BamTools LIBRARY DESTINATION "lib${LIB_SUFFIX}" RUNTIME DESTINATION "bin")
++install( TARGETS BamTools-static ARCHIVE DESTINATION "lib${LIB_SUFFIX}")
+
+ # export API headers
+ include(../ExportHeader.cmake)
diff --git a/sci-biology/bamtools/files/bamtools-2.3.0-unbundle.patch b/sci-biology/bamtools/files/bamtools-2.3.0-unbundle.patch
new file mode 100644
index 000000000000..c07c59d2cddd
--- /dev/null
+++ b/sci-biology/bamtools/files/bamtools-2.3.0-unbundle.patch
@@ -0,0 +1,23 @@
+--- bamtools-2.3.0/src/api/CMakeLists.txt.ori 2013-08-27 18:00:43.000000000 +0200
++++ bamtools-2.3.0/src/api/CMakeLists.txt 2013-08-27 18:00:47.000000000 +0200
+@@ -54,8 +54,8 @@
+ target_link_libraries( BamTools-static ${APILibs} )
+
+ # set library install destinations
+-install( TARGETS BamTools LIBRARY DESTINATION "lib/bamtools" RUNTIME DESTINATION "bin")
+-install( TARGETS BamTools-static ARCHIVE DESTINATION "lib/bamtools")
++install( TARGETS BamTools LIBRARY DESTINATION "lib${LIB_SUFFIX}" RUNTIME DESTINATION "bin")
++install( TARGETS BamTools-static ARCHIVE DESTINATION "lib${LIB_SUFFIX}")
+
+ # export API headers
+ include(../ExportHeader.cmake)
+--- bamtools-2.3.0/src/CMakeLists.txt.ori 2013-08-27 18:03:10.000000000 +0200
++++ bamtools-2.3.0/src/CMakeLists.txt 2013-08-27 18:03:23.000000000 +0200
+@@ -6,7 +6,6 @@
+ # ==========================
+
+ add_subdirectory( api )
+-add_subdirectory( third_party )
+ add_subdirectory( toolkit )
+ add_subdirectory( utils )
+
diff --git a/sci-biology/bamtools/metadata.xml b/sci-biology/bamtools/metadata.xml
new file mode 100644
index 000000000000..f2c00c1fdd0c
--- /dev/null
+++ b/sci-biology/bamtools/metadata.xml
@@ -0,0 +1,14 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <herd>proxy-maintainers</herd>
+ <maintainer>
+ <email>mmokrejs@gmail.com</email>
+ <name>Martin Mokrejs</name>
+ </maintainer>
+ <longdescription>BAM (Binary Alignment/Map) format is useful for storing large DNA sequence alignments. It is closely related to the text-based SAM format, but optimized for random-access. BamTools provides a fast, flexible C++ API for reading and writing BAM files.</longdescription>
+ <upstream>
+ <remote-id type="github">pezmaster31/bamtools</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/beast-mcmc/Manifest b/sci-biology/beast-mcmc/Manifest
new file mode 100644
index 000000000000..7fd843d7d423
--- /dev/null
+++ b/sci-biology/beast-mcmc/Manifest
@@ -0,0 +1,2 @@
+DIST beast-mcmc-1.5.2.tar.bz2 38834702 SHA256 f7312c6a7a14f6b32e9701a6386ff87728574460b7861880aa2cb87290756ea1 SHA512 8549db6cb49d64eb3a97fa6478bdbabfecd44ccc6236c474a1961ec5d6fc8326072fb961035df70982a9f1c08a36572529a07b88e2d33a43fa0fd5c07df3a414 WHIRLPOOL 595f606640daa32c79373c9003ddbc1f80dcbbf01e9e9c18191328b80eb50b45ac70032027dd1efb0e256d78b88bfe1742151a16f6f333938099943a7b2cd16a
+DIST beast-mcmc-1.7.5.tar.xz 40516312 SHA256 905248cbf07513a0d11375656391d86e310d28f07b6fe78de6b9768eb2548f4f SHA512 9b2ab98fdc5a173e8d9fc74d27cdfd8105e9685fdcbe69a373666e77b6865b74fdd87dfa404fc4ab5bea927728d5b6b35fabd5e376a66e5f014e978952797937 WHIRLPOOL 2daded22cfd59b3b44908ce27f4ef61178f5d174de02080a7e94ba311462f482e381556d4b81bc053e33e1c4bb193d172f2c23f331659b3548f7900d3fc297d5
diff --git a/sci-biology/beast-mcmc/beast-mcmc-1.5.2.ebuild b/sci-biology/beast-mcmc/beast-mcmc-1.5.2.ebuild
new file mode 100644
index 000000000000..d25ed786a751
--- /dev/null
+++ b/sci-biology/beast-mcmc/beast-mcmc-1.5.2.ebuild
@@ -0,0 +1,82 @@
+# Copyright 1999-2009 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="2"
+
+ESVN_REPO_URI="http://beast-mcmc.googlecode.com/svn/trunk/"
+
+WANT_ANT_TASKS="ant-junit4"
+EANT_GENTOO_CLASSPATH="colt,jdom-1.0,itext,junit-4,jebl,matrix-toolkits-java,commons-math-2,jdom-jaxen-1.0"
+JAVA_ANT_REWRITE_CLASSPATH="true"
+JAVA_ANT_ENCODING="latin1"
+JAVA_PKG_BSFIX_NAME="build.xml build_BEAST_MCMC.xml build_coalsim.xml build_development.xml build_pathogen.xml build_release.xml build_treestat.xml build_vcs.xml"
+
+#inherit java-pkg-2 java-ant-2 eutils subversion
+inherit java-pkg-2 java-ant-2 eutils
+
+DESCRIPTION="Bayesian MCMC of Evolution & Phylogenetics using Molecular Sequences"
+HOMEPAGE="http://code.google.com/p/beast-mcmc/"
+#SRC_URI=""
+SRC_URI="mirror://gentoo/${P}.tar.bz2"
+
+LICENSE="LGPL-3"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+# TODO: sys-cluster/mpijava
+COMMON_DEPS="dev-java/colt:0
+ dev-java/jdom:1.0
+ dev-java/itext:0
+ dev-java/junit:4
+ dev-java/jebl:0
+ dev-java/matrix-toolkits-java
+ dev-java/commons-math:2
+ dev-java/jdom-jaxen:1.0"
+DEPEND=">=virtual/jdk-1.5
+ ${COMMON_DEPS}"
+RDEPEND=">=virtual/jre-1.5
+ ${COMMON_DEPS}"
+
+S="${WORKDIR}/beast_release_${PV//./_}"
+
+src_prepare() {
+ sed -i '/BEAST_LIB/ s|$BEAST|/usr/share/beast|' "${S}"/scripts/* || die
+ cd lib
+ rm -v colt.jar junit-*.jar itext-*.jar jdom.jar jebl.jar mtj.jar commons-math-*.jar || die
+ java-pkg_jar-from jdom-1.0
+ java-pkg_jar-from colt
+ java-pkg_jar-from itext
+ java-pkg_jar-from jebl
+ java-pkg_jar-from matrix-toolkits-java
+ java-pkg_jar-from commons-math-1
+ java-pkg-2_src_prepare
+}
+
+src_compile() {
+ eant dist_all_BEAST -f build_BEAST_MCMC.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+ eant dist -f build_pathogen.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+}
+
+src_install() {
+ java-pkg_dojar build/dist/*.jar dist/*.jar
+
+ java-pkg_dolauncher beauti --jar beauti.jar --java_args '-Xms64m -Xmx256m'
+# java-pkg_dolauncher beauti --main dr.app.beauti.BeautiApp --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher beast --main dr.app.beast.BeastMain --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher loganalyser --main dr.app.tools.LogAnalyser --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher logcombiner --main dr.app.tools.LogCombiner --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher treeannotator --main dr.app.tools.TreeAnnotator --java_args '-Xms64m -Xmx256m'
+
+ insinto /usr/share/${PN}
+ doins -r examples || die
+ dodoc NOTIFY doc/*.pdf
+}
+
+src_test() {
+ eant junit -f build_BEAST_MCMC.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+}
diff --git a/sci-biology/beast-mcmc/beast-mcmc-1.7.5.ebuild b/sci-biology/beast-mcmc/beast-mcmc-1.7.5.ebuild
new file mode 100644
index 000000000000..35993562814c
--- /dev/null
+++ b/sci-biology/beast-mcmc/beast-mcmc-1.7.5.ebuild
@@ -0,0 +1,86 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+ESVN_REPO_URI="http://beast-mcmc.googlecode.com/svn/trunk/"
+
+WANT_ANT_TASKS="ant-junit4"
+EANT_GENTOO_CLASSPATH="colt,jdom-1.0,itext,junit-4,jebl,matrix-toolkits-java,commons-math-2,jdom-jaxen-1.0"
+JAVA_ANT_REWRITE_CLASSPATH="true"
+JAVA_ANT_ENCODING="latin1"
+JAVA_PKG_BSFIX_NAME="build.xml build_BEAST_MCMC.xml build_coalsim.xml build_development.xml build_pathogen.xml build_release.xml build_treestat.xml build_vcs.xml"
+
+#inherit java-pkg-2 java-ant-2 eutils subversion
+inherit java-pkg-2 java-ant-2 eutils
+
+MY_P=BEASTv${PV}
+
+DESCRIPTION="Bayesian MCMC of Evolution & Phylogenetics using Molecular Sequences"
+HOMEPAGE="http://code.google.com/p/beast-mcmc/"
+#SRC_URI=""
+SRC_URI="http://dev.gentoo.org/~jlec/distfiles/${P}.tar.xz"
+
+LICENSE="LGPL-3"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+# TODO: sys-cluster/mpijava
+COMMON_DEPS="
+ dev-java/colt:0
+ dev-java/jdom:1.0
+ dev-java/itext:0
+ dev-java/junit:4
+ dev-java/jebl:0
+ dev-java/matrix-toolkits-java
+ dev-java/commons-math:2
+ dev-java/jdom-jaxen:1.0"
+DEPEND=">=virtual/jdk-1.5
+ ${COMMON_DEPS}"
+RDEPEND=">=virtual/jre-1.5
+ ${COMMON_DEPS}"
+
+S="${WORKDIR}/beast_release_${PV//./_}"
+
+src_prepare() {
+ sed -i '/BEAST_LIB/ s|$BEAST|/usr/share/beast|' "${S}"/release/Linux/scripts/* || die
+ cd lib
+ rm -v colt.jar junit-*.jar itext-*.jar jdom.jar mtj.jar commons-math-*.jar || die
+ #rm -v colt.jar junit-*.jar itext-*.jar jdom.jar jebl.jar mtj.jar commons-math-*.jar || die
+ java-pkg_jar-from jdom-1.0
+ java-pkg_jar-from colt
+ java-pkg_jar-from itext
+# java-pkg_jar-from jebl
+ java-pkg_jar-from matrix-toolkits-java
+ java-pkg_jar-from commons-math-2
+ java-pkg-2_src_prepare
+}
+
+src_compile() {
+ eant dist_all_BEAST -f build_BEAST_MCMC.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+ eant dist -f build_pathogen.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+}
+
+src_install() {
+ java-pkg_dojar build/dist/*.jar dist/*.jar
+
+ java-pkg_dolauncher beauti --jar beauti.jar --java_args '-Xms64m -Xmx256m'
+# java-pkg_dolauncher beauti --main dr.app.beauti.BeautiApp --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher beast --main dr.app.beast.BeastMain --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher loganalyser --main dr.app.tools.LogAnalyser --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher logcombiner --main dr.app.tools.LogCombiner --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher treeannotator --main dr.app.tools.TreeAnnotator --java_args '-Xms64m -Xmx256m'
+
+ insinto /usr/share/${PN}
+ doins -r examples
+ dodoc NOTIFY doc/*.pdf
+}
+
+src_test() {
+ eant junit -f build.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done)
+}
diff --git a/sci-biology/beast-mcmc/beast-mcmc-9999.ebuild b/sci-biology/beast-mcmc/beast-mcmc-9999.ebuild
new file mode 100644
index 000000000000..30c1a3751011
--- /dev/null
+++ b/sci-biology/beast-mcmc/beast-mcmc-9999.ebuild
@@ -0,0 +1,81 @@
+# Copyright 1999-2009 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="2"
+
+ESVN_REPO_URI="http://beast-mcmc.googlecode.com/svn/trunk/"
+
+WANT_ANT_TASKS="ant-junit4"
+EANT_GENTOO_CLASSPATH="colt,jdom-1.0,itext,junit-4,jebl,matrix-toolkits-java,commons-math-2,jdom-jaxen-1.0"
+JAVA_ANT_REWRITE_CLASSPATH="true"
+JAVA_ANT_ENCODING="latin1"
+JAVA_PKG_BSFIX_NAME="build.xml build_BEAST_MCMC.xml build_coalsim.xml build_development.xml build_pathogen.xml build_release.xml build_treestat.xml build_vcs.xml"
+
+inherit java-pkg-2 java-ant-2 eutils subversion
+
+DESCRIPTION="Bayesian MCMC of Evolution & Phylogenetics using Molecular Sequences"
+HOMEPAGE="http://code.google.com/p/beast-mcmc/"
+SRC_URI=""
+#SRC_URI="mirror://gentoo/${P}.tar.bz2"
+
+LICENSE="LGPL-3"
+SLOT="0"
+KEYWORDS=""
+IUSE=""
+
+# TODO: sys-cluster/mpijava
+COMMON_DEPS="dev-java/colt:0
+ dev-java/jdom:1.0
+ dev-java/itext:0
+ dev-java/junit:4
+ dev-java/jebl:0
+ dev-java/matrix-toolkits-java
+ dev-java/commons-math:2
+ dev-java/jdom-jaxen:1.0"
+DEPEND=">=virtual/jdk-1.5
+ ${COMMON_DEPS}"
+RDEPEND=">=virtual/jre-1.5
+ ${COMMON_DEPS}"
+
+S="${WORKDIR}/beast_release_${PV//./_}"
+
+src_prepare() {
+ sed -i '/BEAST_LIB/ s|$BEAST|/usr/share/beast|' "${S}"/scripts/* || die
+ cd lib
+ rm -v colt.jar junit-*.jar itext-*.jar jdom.jar jebl.jar mtj.jar commons-math-*.jar || die
+ java-pkg_jar-from jdom-1.0
+ java-pkg_jar-from colt
+ java-pkg_jar-from itext
+ java-pkg_jar-from jebl
+ java-pkg_jar-from matrix-toolkits-java
+ java-pkg_jar-from commons-math-1
+ java-pkg-2_src_prepare
+}
+
+src_compile() {
+ eant dist_all_BEAST -f build_BEAST_MCMC.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+ eant dist -f build_pathogen.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+}
+
+src_install() {
+ java-pkg_dojar build/dist/*.jar dist/*.jar
+
+ java-pkg_dolauncher beauti --jar beauti.jar --java_args '-Xms64m -Xmx256m'
+# java-pkg_dolauncher beauti --main dr.app.beauti.BeautiApp --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher beast --main dr.app.beast.BeastMain --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher loganalyser --main dr.app.tools.LogAnalyser --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher logcombiner --main dr.app.tools.LogCombiner --java_args '-Xms64m -Xmx256m'
+ java-pkg_dolauncher treeannotator --main dr.app.tools.TreeAnnotator --java_args '-Xms64m -Xmx256m'
+
+ insinto /usr/share/${PN}
+ doins -r examples || die
+ dodoc NOTIFY doc/*.pdf
+}
+
+src_test() {
+ eant junit -f build_BEAST_MCMC.xml \
+ -Dgentoo.classpath=$(java-pkg_getjars ${EANT_GENTOO_CLASSPATH}):$(for i in lib/*.jar; do echo -n "$i:"; done) || die
+}
diff --git a/sci-biology/beast-mcmc/metadata.xml b/sci-biology/beast-mcmc/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/beast-mcmc/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/bedtools/Manifest b/sci-biology/bedtools/Manifest
new file mode 100644
index 000000000000..e8ecdb88e2ea
--- /dev/null
+++ b/sci-biology/bedtools/Manifest
@@ -0,0 +1,2 @@
+DIST BEDTools.v2.16.2.tar.gz 978293 SHA256 f5f5c864eb3f465ac7fd5fa651e2e4dbc0cd8d9198367148c52f3be3f46c2772
+DIST bedtools-2.20.1.tar.gz 4213348 SHA256 b5401810f8b12b683575f0119521dda64ff2f0a59faa308357405c4ae4e328d3 SHA512 b5c27601365a2126c58492791a52a262c874073cc1626bb1e38545ccf6e3594d12d2d2116304374b3446a588611cfd410c8ff166170823071b33c444c9fd36a7 WHIRLPOOL b768a7e064444d5d0434aea5251e132d68fbeb580783034c8e327666eaace0307febc80e9d6d3eea2f0f648263ce0ac836fac7a676586a6e6a8ec4daf39e6a84
diff --git a/sci-biology/bedtools/bedtools-2.16.2.ebuild b/sci-biology/bedtools/bedtools-2.16.2.ebuild
new file mode 100644
index 000000000000..7de4f347c710
--- /dev/null
+++ b/sci-biology/bedtools/bedtools-2.16.2.ebuild
@@ -0,0 +1,33 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit flag-o-matic
+
+DESCRIPTION="Tools for manipulation and analysis of BED, GFF/GTF, VCF, and SAM/BAM file formats"
+HOMEPAGE="http://code.google.com/p/bedtools/"
+SRC_URI="http://bedtools.googlecode.com/files/BEDTools.v${PV}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~x86 ~amd64"
+IUSE=""
+
+S="${WORKDIR}/BEDTools-Version-${PV}"
+
+src_prepare() {
+ filter-ldflags -Wl,--as-needed
+ sed -i \
+ -e '/export CXXFLAGS/ d' \
+ -e '/export CXX/ d' \
+ Makefile || die
+}
+
+src_install() {
+ dobin bin/*
+ dodoc README* RELEASE_HISTORY
+ insinto /usr/share/${PN}
+ doins -r genomes
+}
diff --git a/sci-biology/bedtools/bedtools-2.20.1.ebuild b/sci-biology/bedtools/bedtools-2.20.1.ebuild
new file mode 100644
index 000000000000..cdba954f6d27
--- /dev/null
+++ b/sci-biology/bedtools/bedtools-2.20.1.ebuild
@@ -0,0 +1,33 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit flag-o-matic
+
+DESCRIPTION="Tools for manipulation and analysis of BED, GFF/GTF, VCF, and SAM/BAM file formats"
+HOMEPAGE="http://code.google.com/p/bedtools/"
+SRC_URI="https://github.com/arq5x/bedtools2/releases/download/v${PV}/bedtools-${PV}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~x86 ~amd64"
+IUSE=""
+
+S="${WORKDIR}/bedtools2-${PV}"
+
+src_prepare() {
+ filter-ldflags -Wl,--as-needed
+ sed -i \
+ -e '/export CXXFLAGS/ d' \
+ -e '/export CXX/ d' \
+ Makefile || die
+}
+
+src_install() {
+ dobin bin/*
+ dodoc README* RELEASE_HISTORY
+ insinto /usr/share/${PN}
+ doins -r genomes
+}
diff --git a/sci-biology/bedtools/metadata.xml b/sci-biology/bedtools/metadata.xml
new file mode 100644
index 000000000000..6edffa4a6dc3
--- /dev/null
+++ b/sci-biology/bedtools/metadata.xml
@@ -0,0 +1,17 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <herd>proxy-maintainers</herd>
+ <maintainer>
+ <email>mmokrejs@gmail.com</email>
+ <name>Martin Mokrejs</name>
+ </maintainer>
+ <longdescription>
+ BEDTools: a flexible suite of utilities for comparing genomic features.
+ </longdescription>
+ <upstream>
+ <remote-id type="google-code">bedtools</remote-id>
+ <remote-id type="github">arq5x/bedtools2</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/bfast/Manifest b/sci-biology/bfast/Manifest
new file mode 100644
index 000000000000..532e6e077652
--- /dev/null
+++ b/sci-biology/bfast/Manifest
@@ -0,0 +1 @@
+DIST bfast-0.7.0a.tar.gz 2456617 SHA256 ed8de49693165a87d5dbef352207c424b1bf6f670a83acf49a4f4f188444995e SHA512 16e7ec5101c478f0dfc171016cbacb2b9240773e43b2d40eeb42d0e47afcee50a6dd5838e043a0326fc1ca9a87d3e55b42326a7f17b7c5654ef9825913860836 WHIRLPOOL f9098c00a2f328fd5116447aae86f0aed078f6c2e6a49a4459e09f0c2a2023e0d60be1893fc2337b85444c24efb2636953517eda2ced336d1bc6dc8d94706e6b
diff --git a/sci-biology/bfast/bfast-0.7.0a.ebuild b/sci-biology/bfast/bfast-0.7.0a.ebuild
new file mode 100644
index 000000000000..908334354033
--- /dev/null
+++ b/sci-biology/bfast/bfast-0.7.0a.ebuild
@@ -0,0 +1,40 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils
+
+DESCRIPTION="Blat-like Fast Accurate Search Tool"
+HOMEPAGE="https://sourceforge.net/projects/bfast/"
+SRC_URI="mirror://sourceforge/${PN}/${P}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+IUSE="test"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND=""
+RDEPEND="dev-perl/XML-Simple"
+
+src_prepare() {
+ sed \
+ -e 's/-m64//' \
+ -e 's/CFLAGS="${default_CFLAGS} ${extended_CFLAGS}"/CFLAGS="${CFLAGS} ${default_CFLAGS} ${extended_CFLAGS}"/' \
+ -e 's:-g -O2::g' \
+ -i configure.ac || die
+ sed \
+ -e 's:. test.definitions.sh:. ./test.definitions.sh:g' \
+ -i tests/*sh || die
+
+ sed \
+ -e '/docdir/d' \
+ -i Makefile.am || die
+
+ use test && AUTOTOOLS_IN_SOURCE_BUILD=1
+
+ autotools-utils_src_prepare
+}
diff --git a/sci-biology/bfast/metadata.xml b/sci-biology/bfast/metadata.xml
new file mode 100644
index 000000000000..45107864e217
--- /dev/null
+++ b/sci-biology/bfast/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="sourceforge">bfast</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/biogrep/Manifest b/sci-biology/biogrep/Manifest
new file mode 100644
index 000000000000..0bd1b4ccfa7a
--- /dev/null
+++ b/sci-biology/biogrep/Manifest
@@ -0,0 +1 @@
+DIST biogrep-1.0.tar.gz 71867 RMD160 8f22aaa432febbf7d433402ca5da1afe7a98a217 SHA1 b4c24777e94d9f04dfda0d2d6a4599e3bc470a4f SHA256 15421d79f6f16d6bf9bef132a97f7f9ede1bd42d3fb90572df04a1e1abd8cfd8
diff --git a/sci-biology/biogrep/biogrep-1.0-r1.ebuild b/sci-biology/biogrep/biogrep-1.0-r1.ebuild
new file mode 100644
index 000000000000..f4af74c73bff
--- /dev/null
+++ b/sci-biology/biogrep/biogrep-1.0-r1.ebuild
@@ -0,0 +1,25 @@
+# Copyright 1999-2010 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="3"
+
+inherit toolchain-funcs
+
+DESCRIPTION="Multithreading application for matching large sets of patternsagainst biosequence dbs"
+HOMEPAGE="http://web.mit.edu/bamel/biogrep.shtml"
+SRC_URI="http://web.mit.edu/bamel/${P}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+src_prepare() {
+ tc-export CC
+}
+
+src_install() {
+ emake prefix="${D}"/usr install || die "install failed"
+ dodoc AUTHORS ChangeLog NEWS README || die "dodoc failed"
+}
diff --git a/sci-biology/biogrep/biogrep-1.0.ebuild b/sci-biology/biogrep/biogrep-1.0.ebuild
new file mode 100644
index 000000000000..b2161dcaae5b
--- /dev/null
+++ b/sci-biology/biogrep/biogrep-1.0.ebuild
@@ -0,0 +1,18 @@
+# Copyright 1999-2010 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+DESCRIPTION="Multithreading application for matching large sets of patterns
+against biosequence dbs."
+HOMEPAGE="http://web.mit.edu/bamel/biogrep.shtml"
+SRC_URI="http://web.mit.edu/bamel/${P}.tar.gz"
+LICENSE="GPL-2"
+
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+src_install() {
+ emake prefix="${D}"/usr install || die "install failed"
+ dodoc AUTHORS ChangeLog NEWS README || die "dodoc failed"
+}
diff --git a/sci-biology/biogrep/metadata.xml b/sci-biology/biogrep/metadata.xml
new file mode 100644
index 000000000000..173e3b48f53e
--- /dev/null
+++ b/sci-biology/biogrep/metadata.xml
@@ -0,0 +1,9 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+<maintainer>
+ <email>jlec@gentoo.org</email>
+</maintainer>
+</pkgmetadata>
+
diff --git a/sci-biology/biojava/Manifest b/sci-biology/biojava/Manifest
new file mode 100644
index 000000000000..3a20f1c431f2
--- /dev/null
+++ b/sci-biology/biojava/Manifest
@@ -0,0 +1,2 @@
+DIST biojava-1.6-all.jar 24571007 SHA256 2d10334fe6022d1b64219505ba4d2a32027ab7218d775878506d3e7c00f6ce7e SHA512 300bd6e02fe052c810c52cb2cc4255628bee704af187ad746b97e57941778dc3a1996b3917db021d74db8c716f94c90c94c5a5e2d4bc212c06259381045f3034 WHIRLPOOL e5a52aaa6e9a9d6780d5f55b6d164db07388e9c595296d4e4a11dc241aa0745fa726279d19a0c97d1966b0a14c06af2b9b588873ad522aeeff881534f0871f10
+DIST biojava-1.7-all.jar 28062592 SHA256 5c5e7fc66bc79a07494fb7d935164ec2aab50dc2effb7644f89bfa4fc907bb3f SHA512 867862b45f014bcd1afd37691e91b948ede05e96f84c7051953d32dad49908781235aad80301e22a15fa8b4145e80c78cf3935d6e581a2e60b56c9308f8adaa8 WHIRLPOOL 5669293ce362e82562454c5902d523e69f64d90e117e75b5de844e0ef5866d250507b86f78245ac82f19932ad9aa196ad17d96a3f703187a3ab2daf00893af9b
diff --git a/sci-biology/biojava/biojava-1.6.ebuild b/sci-biology/biojava/biojava-1.6.ebuild
new file mode 100644
index 000000000000..edfadace1dcc
--- /dev/null
+++ b/sci-biology/biojava/biojava-1.6.ebuild
@@ -0,0 +1,73 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+# TODO:
+# -Fix javadoc generation OutOfMemoryError
+# -Add launchers for 2 apps in biojava-apps.jar
+# -Decide on demo packaging. (Whether to install its jar as done or sources by examples USE flag)
+
+EAPI=2
+
+#JAVA_PKG_IUSE="doc source test"
+JAVA_PKG_IUSE="source test"
+
+inherit eutils java-pkg-2 java-ant-2
+
+DESCRIPTION="A Java framework for processing biological data"
+HOMEPAGE="http://biojava.org"
+SRC_URI="http://www.biojava.org/download/bj16/all/${P}-all.jar"
+LICENSE="LGPL-2.1"
+SLOT="0"
+KEYWORDS="~amd64"
+IUSE=""
+
+COMMON_DEPEND="dev-java/jgrapht:0
+ dev-java/commons-cli:1
+ dev-java/commons-dbcp:0
+ dev-java/commons-pool:0
+ dev-java/bytecode:0"
+
+RDEPEND=">=virtual/jre-1.5
+ ${COMMON_DEPEND}"
+DEPEND=">=virtual/jdk-1.5
+ app-arch/unzip
+ ${COMMON_DEPEND}
+ test?
+ (
+ dev-java/junit:4
+ dev-java/ant-junit4
+ )"
+
+S="${WORKDIR}/biojava-live_${PV}"
+
+JAVA_ANT_IGNORE_SYSTEM_CLASSES="true"
+
+src_prepare() {
+ einfo "Removing budled jars."
+ find . -name "*.jar" -print -delete
+ rm -r doc/*
+ java-pkg_jar-from jgrapht jgrapht.jar jgrapht-jdk1.5.jar
+ java-pkg_jar-from commons-cli-1
+ java-pkg_jar-from commons-dbcp commons-dbcp.jar commons-dbcp-1.1.jar
+ java-pkg_jar-from commons-pool commons-pool.jar commons-pool-1.1.jar
+ java-pkg_jar-from bytecode
+}
+
+src_compile() {
+ #ANT_OPTS="${ANT_OPTS} -Xmx512m"
+ eant package-biojava package-biojava package-demos package-apps #$(use_doc javadocs-all)
+}
+
+src_install() {
+ java-pkg_newjar ant-build/biojava.jar ${PN}.jar
+ java-pkg_newjar ant-build/apps.jar ${PN}-apps.jar
+ java-pkg_newjar ant-build/demos.jar ${PN}-demos.jar
+ #use doc && java-pkg_dojavadoc ant-build/doc/{biojava,apps,demos}
+ use source && java-pkg_dosrc {src,apps,demos}/org
+}
+
+src_test() {
+ java-pkg_jar-from junit-4 junit.jar junit-4.4.jar
+ ANT_TASKS="ant-junit4" eant runtests
+}
diff --git a/sci-biology/biojava/biojava-1.7.ebuild b/sci-biology/biojava/biojava-1.7.ebuild
new file mode 100644
index 000000000000..77ff74c2d159
--- /dev/null
+++ b/sci-biology/biojava/biojava-1.7.ebuild
@@ -0,0 +1,73 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+# TODO:
+# -Fix javadoc generation OutOfMemoryError
+# -Add launchers for 2 apps in biojava-apps.jar
+# -Decide on demo packaging. (Whether to install its jar as done or sources by examples USE flag)
+
+EAPI=2
+
+#JAVA_PKG_IUSE="doc source test"
+JAVA_PKG_IUSE="source test"
+
+inherit eutils java-pkg-2 java-ant-2
+
+DESCRIPTION="A Java framework for processing biological data"
+HOMEPAGE="http://biojava.org"
+SRC_URI="http://www.biojava.org/download/bj17/all/${P}-all.jar"
+LICENSE="LGPL-2.1"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+COMMON_DEPEND="dev-java/jgrapht:0
+ dev-java/commons-cli:1
+ dev-java/commons-dbcp:0
+ dev-java/commons-pool:0
+ dev-java/commons-collections:0
+ dev-java/bytecode:0"
+
+RDEPEND=">=virtual/jre-1.5
+ ${COMMON_DEPEND}"
+DEPEND=">=virtual/jdk-1.5
+ app-arch/unzip
+ ${COMMON_DEPEND}
+ test?
+ (
+ dev-java/junit:4
+ dev-java/ant-junit4
+ )"
+
+S="${WORKDIR}/biojava-${PV}"
+
+JAVA_ANT_IGNORE_SYSTEM_CLASSES="true"
+
+src_prepare() {
+ einfo "Removing bundled jars..."
+ find . -name "*.jar" -print -delete
+ java-pkg_jar-from jgrapht jgrapht.jar jgrapht-jdk1.5.jar
+ java-pkg_jar-from commons-cli-1
+ java-pkg_jar-from commons-dbcp commons-dbcp.jar commons-dbcp-1.1.jar
+ java-pkg_jar-from commons-pool commons-pool.jar commons-pool-1.1.jar
+ java-pkg_jar-from bytecode
+}
+
+src_compile() {
+ #ANT_OPTS="${ANT_OPTS} -Xmx512m"
+ eant package-biojava package-biojava package-demos package-apps #$(use_doc javadocs-all)
+}
+
+src_install() {
+ java-pkg_newjar ant-build/biojava.jar ${PN}.jar
+ java-pkg_newjar ant-build/apps.jar ${PN}-apps.jar
+ java-pkg_newjar ant-build/demos.jar ${PN}-demos.jar
+ #use doc && java-pkg_dojavadoc ant-build/doc/{biojava,apps,demos}
+ use source && java-pkg_dosrc {src,apps,demos}/org
+}
+
+src_test() {
+ java-pkg_jar-from junit-4 junit.jar junit-4.4.jar
+ ANT_TASKS="ant-junit4" eant runtests
+}
diff --git a/sci-biology/biojava/metadata.xml b/sci-biology/biojava/metadata.xml
new file mode 100644
index 000000000000..0a18364544e8
--- /dev/null
+++ b/sci-biology/biojava/metadata.xml
@@ -0,0 +1,6 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <herd>java</herd>
+</pkgmetadata>
diff --git a/sci-biology/bioperl-db/Manifest b/sci-biology/bioperl-db/Manifest
new file mode 100644
index 000000000000..b189a8ae405f
--- /dev/null
+++ b/sci-biology/bioperl-db/Manifest
@@ -0,0 +1 @@
+DIST BioPerl-DB-1.006900.tar.gz 492799 SHA256 50df2447b7f3e26aebcf02ed7344d3ef562c3f5393c1584a8ae086185c8c9139 SHA512 e06b8b9aa4188a83128f910d7b4a031f69d36f75e4f2d7210357366379024ef39b58eca97112b5b419f141c82b7518086273cc97c9637382ee5e0ddb9ce28746 WHIRLPOOL b484ce9f464a7189e5b2fffd6facdd426e8b9009ffca5e1661986490bc45dc0269faec5e9eeebdb23ec5c706f62a670fbb6bfc5a60b11c268c7e6f34bf1f03f2
diff --git a/sci-biology/bioperl-db/bioperl-db-1.6.9.ebuild b/sci-biology/bioperl-db/bioperl-db-1.6.9.ebuild
new file mode 100644
index 000000000000..b78237d1e434
--- /dev/null
+++ b/sci-biology/bioperl-db/bioperl-db-1.6.9.ebuild
@@ -0,0 +1,34 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+BIOPERL_RELEASE=1.6.9
+
+MY_PN=BioPerl-DB
+MODULE_AUTHOR=CJFIELDS
+MODULE_VERSION=1.006900
+inherit perl-module
+
+DESCRIPTION="Perl tools for bioinformatics - Perl API that accesses the BioSQL schema"
+HOMEPAGE="http://www.bioperl.org/"
+
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="test"
+SRC_TEST="do"
+
+CDEPEND="
+ >=sci-biology/bioperl-${PV}
+ dev-perl/DBD-mysql
+ dev-perl/DBI
+ sci-biology/biosql"
+DEPEND="${CDEPEND}
+ dev-perl/Module-Build"
+RDEPEND="${CDEPEND}"
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl-db/bioperl-db-9999-r1.ebuild b/sci-biology/bioperl-db/bioperl-db-9999-r1.ebuild
new file mode 100644
index 000000000000..aad5b6e4abe5
--- /dev/null
+++ b/sci-biology/bioperl-db/bioperl-db-9999-r1.ebuild
@@ -0,0 +1,39 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+inherit perl-module git-2
+
+DESCRIPTION="Perl tools for bioinformatics - Perl API that accesses the BioSQL schema"
+HOMEPAGE="http://www.bioperl.org/"
+SRC_URI=""
+EGIT_REPO_URI="git://github.com/bioperl/${PN}.git
+ https://github.com/bioperl/${PN}.git"
+
+LICENSE="Artistic GPL-2"
+SLOT="0"
+KEYWORDS=""
+IUSE=""
+
+CDEPEND=">=sci-biology/bioperl-${PV}
+ dev-perl/DBI
+ sci-biology/biosql"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+S="${WORKDIR}/BioPerl-db-${PV}"
+
+src_configure() {
+ # This disables tests. TODO: Enable tests
+ sed -i -e '/biosql_conf();/d' \
+ -e '/skip.*DBHarness.biosql.conf/d' "${S}/Build.PL" || die
+ perl-module_src_configure
+}
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl-db/metadata.xml b/sci-biology/bioperl-db/metadata.xml
new file mode 100644
index 000000000000..642468c809b7
--- /dev/null
+++ b/sci-biology/bioperl-db/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="cpan">BioPerl-DB</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/bioperl-network/Manifest b/sci-biology/bioperl-network/Manifest
new file mode 100644
index 000000000000..54877a23bece
--- /dev/null
+++ b/sci-biology/bioperl-network/Manifest
@@ -0,0 +1 @@
+DIST BioPerl-Network-1.006900.tar.gz 2198089 SHA256 5b31ab7d048ee8e7bd6ba933f96b904d7ee06b46ab29c00276eca3513a77c32a SHA512 d0a95af17cb024cbc615c784f1dbcddd7bfc5b54524163ab127f1077ded18df222fe067c085f3dd17dd416d6417b8f726526be164e1e33144991393f6b6d5842 WHIRLPOOL 65ff9e2509c0136232b7cff1aa5e8ad55f26241f51e70e6d34f9383c0af4bfdb0c5358b1a69075d480e9e1fdfa19342058fbe33ea4d4a633220ef3a80d6ed984
diff --git a/sci-biology/bioperl-network/bioperl-network-1.6.9.ebuild b/sci-biology/bioperl-network/bioperl-network-1.6.9.ebuild
new file mode 100644
index 000000000000..285db499bff4
--- /dev/null
+++ b/sci-biology/bioperl-network/bioperl-network-1.6.9.ebuild
@@ -0,0 +1,31 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+BIOPERL_RELEASE=1.6.9
+
+MY_PN=BioPerl-Network
+MODULE_AUTHOR=CJFIELDS
+MODULE_VERSION=1.006900
+inherit perl-module
+
+DESCRIPTION="Perl tools for bioinformatics - Analysis of protein-protein interaction networks"
+HOMEPAGE="http://www.bioperl.org/"
+
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="test"
+SRC_TEST="do"
+
+CDEPEND=">=sci-biology/bioperl-${PV}
+ >=dev-perl/Graph-0.86"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+src_install() {
+ mydoc="AUTHORS BUGS"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl-network/bioperl-network-9999-r1.ebuild b/sci-biology/bioperl-network/bioperl-network-9999-r1.ebuild
new file mode 100644
index 000000000000..5b93a4ddbeed
--- /dev/null
+++ b/sci-biology/bioperl-network/bioperl-network-9999-r1.ebuild
@@ -0,0 +1,32 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+inherit perl-module git-2
+
+DESCRIPTION="Perl tools for bioinformatics - Analysis of protein-protein interaction networks"
+HOMEPAGE="http://www.bioperl.org/"
+SRC_URI=""
+EGIT_REPO_URI="git://github.com/bioperl/${PN}.git
+ https://github.com/bioperl/${PN}.git"
+
+LICENSE="Artistic GPL-2"
+SLOT="0"
+KEYWORDS=""
+IUSE="test"
+SRC_TEST="do"
+
+CDEPEND=">=sci-biology/bioperl-${PV}
+ >=dev-perl/Graph-0.86"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+S="${WORKDIR}/BioPerl-network-${PV}"
+
+src_install() {
+ mydoc="AUTHORS BUGS"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl-network/metadata.xml b/sci-biology/bioperl-network/metadata.xml
new file mode 100644
index 000000000000..045af7cc6148
--- /dev/null
+++ b/sci-biology/bioperl-network/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="cpan">BioPerl-Network</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/bioperl-run/Manifest b/sci-biology/bioperl-run/Manifest
new file mode 100644
index 000000000000..bd1970f7c390
--- /dev/null
+++ b/sci-biology/bioperl-run/Manifest
@@ -0,0 +1 @@
+DIST BioPerl-Run-1.006900.tar.gz 14546677 SHA256 6eddca8aae38a139caaa0b28505e2ff3e919e8ed39b7539a662b0145f1f08d96 SHA512 47f2b853885c604291ac0aba3269b897de59cf7da6f7d54a50ff950cca836338091309df550f32695159c620be23391306d0421d2bbc22eebbb61a9e280ad83c WHIRLPOOL a671180b3680d94683e771ba661e0f86430814200efcd8df1552dbc3c30228d90ea8be1b47cc36603cbfc6eadacb276414ae6d79e30ec80495fd836eb1732cca
diff --git a/sci-biology/bioperl-run/bioperl-run-1.6.9.ebuild b/sci-biology/bioperl-run/bioperl-run-1.6.9.ebuild
new file mode 100644
index 000000000000..d633fe3be7a1
--- /dev/null
+++ b/sci-biology/bioperl-run/bioperl-run-1.6.9.ebuild
@@ -0,0 +1,42 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+BIOPERL_RELEASE=1.6.9
+
+MY_PN=BioPerl-Run
+MODULE_AUTHOR=CJFIELDS
+MODULE_VERSION=1.006900
+inherit perl-module
+
+DESCRIPTION="Perl tools for bioinformatics - Wrapper modules around key bioinformatics applications"
+HOMEPAGE="http://www.bioperl.org/"
+
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="-minimal test"
+#SRC_TEST="do"
+
+RESTRICT="test"
+
+CDEPEND=">=sci-biology/bioperl-${BIOPERL_RELEASE}
+ !minimal? (
+ dev-perl/Algorithm-Diff
+ dev-perl/XML-Twig
+ dev-perl/IO-String
+ dev-perl/IPC-Run
+ dev-perl/File-Sort
+ )"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+ # TODO: File collision in Bio/ConfigData.pm (a Module::Build internal file)
+ # with sci-biology/bioperl. Workaround: the "nuke it from orbit" solution :D
+ #find "${D}" -name '*ConfigData*' -print -delete
+}
diff --git a/sci-biology/bioperl-run/bioperl-run-9999-r1.ebuild b/sci-biology/bioperl-run/bioperl-run-9999-r1.ebuild
new file mode 100644
index 000000000000..13c3ca1477da
--- /dev/null
+++ b/sci-biology/bioperl-run/bioperl-run-9999-r1.ebuild
@@ -0,0 +1,42 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+inherit perl-module git-2
+
+DESCRIPTION="Perl tools for bioinformatics - Wrapper modules around key bioinformatics applications"
+HOMEPAGE="http://www.bioperl.org/"
+SRC_URI=""
+EGIT_REPO_URI="git://github.com/bioperl/${PN}.git
+ https://github.com/bioperl/${PN}.git"
+
+LICENSE="Artistic GPL-2"
+SLOT="0"
+KEYWORDS=""
+IUSE="-minimal test"
+#SRC_TEST="do"
+
+RESTRICT="test"
+
+CDEPEND=">=sci-biology/bioperl-${PV}
+ !minimal? (
+ dev-perl/Algorithm-Diff
+ dev-perl/XML-Twig
+ dev-perl/IO-String
+ dev-perl/IPC-Run
+ )"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+
+S="${WORKDIR}/BioPerl-run-${PV}"
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+ # TODO: File collision in Bio/ConfigData.pm (a Module::Build internal file)
+ # with sci-biology/bioperl. Workaround: the "nuke it from orbit" solution :D
+ find "${D}" -name '*ConfigData*' -print -delete
+}
diff --git a/sci-biology/bioperl-run/files/bioperl-run-Pise-test-patch.diff b/sci-biology/bioperl-run/files/bioperl-run-Pise-test-patch.diff
new file mode 100644
index 000000000000..5683347a6b52
--- /dev/null
+++ b/sci-biology/bioperl-run/files/bioperl-run-Pise-test-patch.diff
@@ -0,0 +1,22 @@
+--- Makefile.PL.original 2003-09-28 23:33:16.000000000 -0400
++++ Makefile.PL 2003-09-28 23:33:50.000000000 -0400
+@@ -73,19 +73,6 @@
+ my $DISTNAME = "bioperl-run";
+ my $VERSION = "1.2.2";
+
+-my $proceed = prompt("Do you want to run the Pise tests (requires a network connection) y/n",'n');
+-if( $proceed =~ /^[yY]/) {
+- my $address = prompt("Enter your email address (no default)",'');
+-
+- if (open T,">t/pise-email.test") {
+-print T "$address\n";
+-close T;
+- } else { warn("Cannot open file t/pise-email.test for writing - no Pise tests will be run"); }
+-} else {
+- if( -e "t/pise-email.test" ) {
+-unlink "t/pise-email.test";
+- }
+-}
+ #$do_autoload_finesse = 0;
+ #$NAME = 'Bio';
+ #$DISTNAME = "GFD";
diff --git a/sci-biology/bioperl-run/metadata.xml b/sci-biology/bioperl-run/metadata.xml
new file mode 100644
index 000000000000..f8c7078a2813
--- /dev/null
+++ b/sci-biology/bioperl-run/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="cpan">BioPerl-Run</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/bioperl/Manifest b/sci-biology/bioperl/Manifest
new file mode 100644
index 000000000000..756ab900c480
--- /dev/null
+++ b/sci-biology/bioperl/Manifest
@@ -0,0 +1 @@
+DIST BioPerl-1.6.901.tar.gz 12284856 SHA256 8c74bde900222ce3926491ee103997c841c8755148c8dcaf0be1abfd61c5ac01 SHA512 227387437c940da1435ed83fad6ec2168ca12a729c90dc557e84750c6474213874c23a8f23e50db4027909469627baee581faa11be6208c8e0a5453a01c7eca4 WHIRLPOOL feb1f93a617e0135ab84b0eeb36ac986e817ce76ada0f40518090f6a480fbb1047339b33fcd11ccff444f89c4a06c41b5abaab66b662a50f17ae34f9b22d66fd
diff --git a/sci-biology/bioperl/bioperl-1.6.9.ebuild b/sci-biology/bioperl/bioperl-1.6.9.ebuild
new file mode 100644
index 000000000000..afaa8236b5a2
--- /dev/null
+++ b/sci-biology/bioperl/bioperl-1.6.9.ebuild
@@ -0,0 +1,68 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+MY_PN=BioPerl
+MODULE_AUTHOR=CJFIELDS
+MODULE_VERSION=1.6.901
+inherit perl-module
+
+SUBPROJECTS="+db +network +run"
+MIN_PV=$PV
+
+DESCRIPTION="Perl tools for bioinformatics - Core modules"
+HOMEPAGE="http://www.bioperl.org/"
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE="-minimal graphviz sqlite ${SUBPROJECTS}"
+
+REQUIRED_USE="minimal? ( !graphviz )"
+
+CDEPEND="
+ dev-perl/libwww-perl
+ !minimal? (
+ dev-perl/Algorithm-Munkres
+ dev-perl/Array-Compare
+ dev-perl/yaml
+ dev-perl/Bio-ASN1-EntrezGene
+ dev-perl/Clone
+ dev-perl/Convert-Binary-C
+ dev-perl/Data-Stag
+ dev-perl/GD
+ dev-perl/Graph
+ >=dev-perl/HTML-Parser-3.60
+ dev-perl/List-MoreUtils
+ dev-perl/Math-Random
+ dev-perl/PostScript
+ dev-perl/set-scalar
+ dev-perl/SOAP-Lite
+ dev-perl/Sort-Naturally
+ dev-perl/Spreadsheet-ParseExcel
+ >=virtual/perl-Storable-2.05
+ >=dev-perl/SVG-2.26
+ >=dev-perl/SVG-Graph-0.01
+ dev-perl/URI
+ >=dev-perl/XML-DOM-XPath-0.13
+ dev-perl/XML-Parser
+ >=dev-perl/XML-SAX-0.15
+ dev-perl/XML-Simple
+ dev-perl/XML-Twig
+ >=dev-perl/XML-Writer-0.4
+ dev-perl/XML-DOM
+ dev-perl/XML-XPath
+ )
+ graphviz? ( dev-perl/GraphViz )
+ sqlite? ( dev-perl/DBD-SQLite )"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+PDEPEND="db? ( >=sci-biology/bioperl-db-${MIN_PV} )
+ network? ( >=sci-biology/bioperl-network-${MIN_PV} )
+ run? ( >=sci-biology/bioperl-run-${MIN_PV} )"
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl/bioperl-9999-r1.ebuild b/sci-biology/bioperl/bioperl-9999-r1.ebuild
new file mode 100644
index 000000000000..1cf70db6b533
--- /dev/null
+++ b/sci-biology/bioperl/bioperl-9999-r1.ebuild
@@ -0,0 +1,75 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+inherit perl-module git-2
+
+SUBPROJECTS="+db +network +run"
+
+DESCRIPTION="Perl tools for bioinformatics - Core modules"
+HOMEPAGE="http://www.bioperl.org/"
+SRC_URI=""
+EGIT_REPO_URI="git://github.com/${PN}/${PN}-live.git
+ https://github.com/${PN}/${PN}-live.git"
+
+LICENSE="Artistic GPL-2"
+SLOT="0"
+KEYWORDS=""
+IUSE="-minimal graphviz ${SUBPROJECTS}"
+
+CDEPEND="
+ dev-perl/Data-Stag
+ dev-perl/libwww-perl
+ !minimal? (
+ dev-perl/Ace
+ dev-perl/Bio-ASN1-EntrezGene
+ dev-perl/Spreadsheet-ParseExcel
+ dev-perl/Spreadsheet-WriteExcel
+ >=dev-perl/XML-SAX-0.15
+ dev-perl/Graph
+ dev-perl/SOAP-Lite
+ dev-perl/Array-Compare
+ dev-perl/SVG
+ dev-perl/XML-Simple
+ dev-perl/XML-Parser
+ dev-perl/XML-Twig
+ >=dev-perl/HTML-Parser-3.60
+ >=dev-perl/XML-Writer-0.4
+ dev-perl/Clone
+ dev-perl/XML-DOM
+ dev-perl/set-scalar
+ dev-perl/XML-XPath
+ dev-perl/XML-DOM-XPath
+ dev-perl/Algorithm-Munkres
+ dev-perl/Data-Stag
+ dev-perl/Math-Random
+ dev-perl/PostScript
+ dev-perl/Convert-Binary-C
+ dev-perl/SVG-Graph
+ )
+ graphviz? ( dev-perl/GraphViz )"
+DEPEND="dev-perl/Module-Build
+ ${CDEPEND}"
+RDEPEND="${CDEPEND}"
+PDEPEND="!minimal? ( dev-perl/Bio-ASN1-EntrezGene )
+ db? ( >=sci-biology/bioperl-db-${PV} )
+ network? ( >=sci-biology/bioperl-network-${PV} )
+ run? ( >=sci-biology/bioperl-run-${PV} )"
+
+S="${WORKDIR}/BioPerl-${PV}"
+
+src_configure() {
+ sed -i -e '/add_post_install_script.*symlink_script.pl/d' \
+ -e "/'CPAN' *=> *1.81/d" "${S}/Build.PL" \
+ -e "/'ExtUtils::Manifest' *=> *'1.52'/d" "${S}/Build.PL" \
+ || die
+ if use minimal && use graphviz; then die "USE flags minimal and graphviz cannot be used together"; fi
+ perl-module_src_configure
+}
+
+src_install() {
+ mydoc="AUTHORS BUGS FAQ"
+ perl-module_src_install
+}
diff --git a/sci-biology/bioperl/metadata.xml b/sci-biology/bioperl/metadata.xml
new file mode 100644
index 000000000000..210ba364d45f
--- /dev/null
+++ b/sci-biology/bioperl/metadata.xml
@@ -0,0 +1,13 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <use>
+ <flag name="run">Install sci-biology/bioperl-run</flag>
+ <flag name="network">Install sci-biology/bioperl-run</flag>
+ <flag name="db">Install sci-biology/bioperl-run</flag>
+ </use>
+ <upstream>
+ <remote-id type="cpan">BioPerl</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/biopython/Manifest b/sci-biology/biopython/Manifest
new file mode 100644
index 000000000000..e835e2490342
--- /dev/null
+++ b/sci-biology/biopython/Manifest
@@ -0,0 +1 @@
+DIST biopython-1.65.tar.gz 12641342 SHA256 463cc81db84e9bfcdfb15629511c81ed556a6c0287e670dbfe80f03c65d2a88e SHA512 2a9c6a89d0279374c243938d13bfdd6f2b124a08afbfb0c262e1e4827c48a141fb9941f4cdb960f76b523f0ac152095a8c6ea566d9b469ce9daf8a7e7993f7af WHIRLPOOL 40757938c0eb7e30c9609ef5aa2d397fa21ad92cd20c9b6300cde1b381a0e6c21e4ebb7f4d25bf02651789437d7d86341154b907ccc0007759c17939f2e29da2
diff --git a/sci-biology/biopython/biopython-1.65.ebuild b/sci-biology/biopython/biopython-1.65.ebuild
new file mode 100644
index 000000000000..9c23f0bd0635
--- /dev/null
+++ b/sci-biology/biopython/biopython-1.65.ebuild
@@ -0,0 +1,56 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+PYTHON_COMPAT=( python2_7 python3_{3,4} pypy )
+
+inherit distutils-r1 eutils
+
+DESCRIPTION="Python modules for computational molecular biology"
+HOMEPAGE="http://www.biopython.org/ http://pypi.python.org/pypi/biopython/"
+SRC_URI="http://www.biopython.org/DIST/${P}.tar.gz"
+
+LICENSE="HPND"
+SLOT="0"
+KEYWORDS="amd64 ppc x86 ~amd64-linux ~x86-linux"
+IUSE=""
+
+RDEPEND="
+ dev-python/matplotlib[$(python_gen_usedep 'python*')]
+ dev-python/networkx[$(python_gen_usedep 'python*')]
+ dev-python/numpy[$(python_gen_usedep 'python*')]
+ dev-python/rdflib[$(python_gen_usedep 'python*')]
+ dev-python/pygraphviz[$(python_gen_usedep 'python2*')]
+ dev-python/reportlab[$(python_gen_usedep 'python*')]
+ media-gfx/pydot[$(python_gen_usedep 'python2*')]
+ "
+DEPEND="${RDEPEND}
+ sys-devel/flex"
+
+DOCS=( CONTRIB DEPRECATED NEWS README Doc/. )
+
+PATCHES=( "${FILESDIR}"/${P}-test-fix-backport.patch )
+
+python_test() {
+ [[ ${EPYTHON} == pypy ]] && return
+ cd Tests || die
+ ${PYTHON} run_tests.py || die
+}
+
+python_install_all() {
+ distutils-r1_python_install_all
+
+ dodir /usr/share/${PN}
+ cp -r --preserve=mode Scripts Tests "${ED}"/usr/share/${PN} || die
+}
+
+pkg_postinst() {
+ elog "For database support you need to install:"
+ optfeature "MySQL" dev-python/mysql-python
+ optfeature "PostGreSQL" dev-python/psycopg
+ echo
+ elog "Some applications need extra packages:"
+ optfeature "EMBOSS (The European Molecular Biology Open Software Suite)" sci-biology/emboss
+}
diff --git a/sci-biology/biopython/files/biopython-1.65-test-fix-backport.patch b/sci-biology/biopython/files/biopython-1.65-test-fix-backport.patch
new file mode 100644
index 000000000000..2efdef97d799
--- /dev/null
+++ b/sci-biology/biopython/files/biopython-1.65-test-fix-backport.patch
@@ -0,0 +1,40 @@
+From 08c72f8778a87701586a03dffcce33c7589bc6d7 Mon Sep 17 00:00:00 2001
+From: Peter Cock <p.j.a.cock@googlemail.com>
+Date: Sun, 18 Jan 2015 02:07:54 +0000
+Subject: [PATCH] Clearer error message; update failing test.
+
+One of the orchid examples now returns different enough
+results that the test was failing. The new error message
+makes it much easier to pick another positive example to
+add to the the white-list.
+---
+ Tests/test_NCBI_qblast.py | 9 +++++----
+ 1 file changed, 5 insertions(+), 4 deletions(-)
+
+diff --git a/Tests/test_NCBI_qblast.py b/Tests/test_NCBI_qblast.py
+index 88bfe61..19f7b35 100644
+--- a/Tests/test_NCBI_qblast.py
++++ b/Tests/test_NCBI_qblast.py
+@@ -66,7 +66,7 @@ def test_orchid_est(self):
+ AGCCATGGATTTCTCAGAAGAAAATGATTATACTTCTTAATCAGGCAACTGATATTATCAATTTATGGCA
+ GCAGAGTGGTGGCTCCTTGTCCCAGCAGCAGTAATTACTTTTTTTTCTCTTTTTGTTTCCAAATTAAGAA
+ ACATTAGTATCATATGGCTATTTGCTCAATTGCAGATTTCTTTCTTTTGTGAATG""",
+- 0.0000001, None, ["21554275", "18409071", "296087288"])
++ 0.0000001, None, ["21554275", "18409071", "296087288", "566183510"])
+
+ def run_qblast(self, program, database, query, e_value, entrez_filter, expected_hits):
+ try:
+@@ -120,9 +120,10 @@ def run_qblast(self, program, database, query, e_value, entrez_filter, expected_
+ print("Update this test to have some redundancy...")
+ for alignment in record.alignments:
+ print(alignment.hit_id)
+- assert found_result, "Missing all of %s in alignments" \
+- % ", ".join(expected_hits)
+- self.assertTrue(found_result)
++ self.assertTrue(found_result,
++ "Missing all expected hits (%s), instead have: %s"
++ % (", ".join(expected_hits),
++ ", ".join(a.hit_id for a in record.alignments)))
+
+ # Check the expected result(s) are found in the descriptions
+ if expected_hits is None:
diff --git a/sci-biology/biopython/metadata.xml b/sci-biology/biopython/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/biopython/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/bioruby/Manifest b/sci-biology/bioruby/Manifest
new file mode 100644
index 000000000000..9c1f1499ea6f
--- /dev/null
+++ b/sci-biology/bioruby/Manifest
@@ -0,0 +1 @@
+DIST bioruby-1.4.3.0001.tar.gz 1500656 SHA256 20d6548e1c5977464afd74019693dde9e45a030d48d974db08a7b85c4214fb35 SHA512 77ad96388e1e8b1dccab582a3bc309b99b36cac1803f79b42707fc4dbf439de31ed491ce5e1c2e59f695643756ae0df2e275bbcd9ad6827f251b52edd677d821 WHIRLPOOL ccb952d4cd3b8700acbf356a0965842b068aa2fb861dfab58e7442e5570ab79604a8be1fb86a9d80d6bc9a8f9dc886daf98cb84fe7298b4f334e0e6be198f9e7
diff --git a/sci-biology/bioruby/bioruby-1.4.3.0001-r1.ebuild b/sci-biology/bioruby/bioruby-1.4.3.0001-r1.ebuild
new file mode 100644
index 000000000000..b50f3fa137fb
--- /dev/null
+++ b/sci-biology/bioruby/bioruby-1.4.3.0001-r1.ebuild
@@ -0,0 +1,38 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+USE_RUBY="ruby19 ruby20"
+
+inherit ruby-fakegem
+
+DESCRIPTION="An integrated environment for bioinformatics using the Ruby language"
+LICENSE="Ruby"
+HOMEPAGE="http://www.bioruby.org/"
+SRC_URI="http://www.${PN}.org/archive/${P}.tar.gz"
+
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 ~ppc x86"
+
+ruby_add_rdepend "dev-ruby/libxml"
+
+PATCHES=( "${FILESDIR}"/${P}-fix-tests.patch )
+
+each_ruby_configure() {
+ ${RUBY} setup.rb config || die
+}
+
+each_ruby_compile() {
+ ${RUBY} setup.rb setup || die
+}
+
+each_ruby_install() {
+ ${RUBY} setup.rb install --prefix="${D}" || die
+}
+
+each_ruby_test() {
+ ${RUBY} -rubygems test/runner.rb || die
+}
diff --git a/sci-biology/bioruby/bioruby-9999.ebuild b/sci-biology/bioruby/bioruby-9999.ebuild
new file mode 100644
index 000000000000..838f8430c972
--- /dev/null
+++ b/sci-biology/bioruby/bioruby-9999.ebuild
@@ -0,0 +1,41 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+USE_RUBY="ruby19 ruby20"
+EGIT_REPO_URI="git://github.com/bioruby/bioruby.git
+ https://github.com/bioruby/bioruby.git"
+
+inherit git-2 ruby-fakegem
+
+DESCRIPTION="An integrated environment for bioinformatics using the Ruby language"
+LICENSE="Ruby"
+HOMEPAGE="http://www.bioruby.org/"
+SRC_URI=""
+SLOT="0"
+IUSE=""
+KEYWORDS=""
+
+ruby_add_rdepend "dev-ruby/libxml"
+
+all_ruby_unpack() {
+ git-2_src_unpack
+}
+
+each_ruby_configure() {
+ ${RUBY} setup.rb config || die
+}
+
+each_ruby_compile() {
+ ${RUBY} setup.rb setup || die
+}
+
+each_ruby_install() {
+ ${RUBY} setup.rb install --prefix="${D}" || die
+}
+
+each_ruby_test() {
+ ${RUBY} -rubygems test/runner.rb || die
+}
diff --git a/sci-biology/bioruby/files/bioruby-1.4.3.0001-fix-tests.patch b/sci-biology/bioruby/files/bioruby-1.4.3.0001-fix-tests.patch
new file mode 100644
index 000000000000..71c4ca27104a
--- /dev/null
+++ b/sci-biology/bioruby/files/bioruby-1.4.3.0001-fix-tests.patch
@@ -0,0 +1,29 @@
+From edda65b8fb32c2eee6b0652074981c31aa68b0eb Mon Sep 17 00:00:00 2001
+From: Naohisa Goto <ng@bioruby.org>
+Date: Fri, 23 Aug 2013 23:51:59 +0900
+Subject: [PATCH] Test bug fix: Read test file with binary mode to avoid
+ encoding error
+
+ * Test bug fix: Read test file with binary mode to avoid string encoding
+ error. Thanks to nieder (github.com/nieder) who reports the bug.
+ (https://github.com/bioruby/bioruby/issues/84)
+---
+ test/unit/bio/db/test_phyloxml.rb | 2 +-
+ 1 file changed, 1 insertion(+), 1 deletion(-)
+
+diff --git a/test/unit/bio/db/test_phyloxml.rb b/test/unit/bio/db/test_phyloxml.rb
+index 0744c64..c24278d 100644
+--- a/test/unit/bio/db/test_phyloxml.rb
++++ b/test/unit/bio/db/test_phyloxml.rb
+@@ -100,7 +100,7 @@ def test_open_with_block
+ end
+
+ def test_new
+- str = File.read(TestPhyloXMLData.example_xml)
++ str = File.open(TestPhyloXMLData.example_xml, "rb") { |f| f.read }
+ assert_instance_of(Bio::PhyloXML::Parser,
+ phyloxml = Bio::PhyloXML::Parser.new(str))
+ common_test_next_tree(phyloxml)
+--
+1.8.4
+
diff --git a/sci-biology/bioruby/metadata.xml b/sci-biology/bioruby/metadata.xml
new file mode 100644
index 000000000000..d4648212cbad
--- /dev/null
+++ b/sci-biology/bioruby/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/biosql/Manifest b/sci-biology/biosql/Manifest
new file mode 100644
index 000000000000..cd5198309e65
--- /dev/null
+++ b/sci-biology/biosql/Manifest
@@ -0,0 +1 @@
+DIST biosql-1.0.1.tar.bz2 253516 SHA256 3604ceaf6f3e42a11613b49577b7c68f04d9e094cca4e5d932359c815fc9ad01
diff --git a/sci-biology/biosql/biosql-1.0.1.ebuild b/sci-biology/biosql/biosql-1.0.1.ebuild
new file mode 100644
index 000000000000..ed77d3770701
--- /dev/null
+++ b/sci-biology/biosql/biosql-1.0.1.ebuild
@@ -0,0 +1,33 @@
+# Copyright 1999-2009 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+DESCRIPTION="A generic bioinformatics relational database model"
+HOMEPAGE="http://www.biosql.org/"
+SRC_URI="http://biosql.org/DIST/${P}.tar.bz2"
+
+LICENSE="LGPL-3"
+SLOT="0"
+IUSE="mysql postgres"
+KEYWORDS="amd64 x86"
+
+# WARNING: bioperl-db is claimed to be incompatible with >=postgresql-8.3 (see INSTALL)
+
+DEPEND="mysql? ( dev-perl/DBD-mysql )
+ postgres? ( dev-perl/DBD-Pg )"
+RDEPEND="${DEPEND}"
+
+src_install() {
+ insinto /usr/share/${PN}
+ doins -r sql scripts/* || die
+ insinto /usr/share/doc/${P}
+ doins -r doc/*
+ dodoc Changes INSTALL README Release.txt
+}
+
+pkg_postinst() {
+ echo
+ elog "Please read the BioSQL schema installation instructions in"
+ elog "/usr/share/doc/${P} to begin using the schema."
+ echo
+}
diff --git a/sci-biology/biosql/metadata.xml b/sci-biology/biosql/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/biosql/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/blat/Manifest b/sci-biology/blat/Manifest
new file mode 100644
index 000000000000..c1b249e1a095
--- /dev/null
+++ b/sci-biology/blat/Manifest
@@ -0,0 +1 @@
+DIST blatSrc34.zip 2142975 SHA256 b764828fdf8ef4c9994ae4b6148340a776493475edb573b6adf63ae7ca9b2629
diff --git a/sci-biology/blat/blat-34-r1.ebuild b/sci-biology/blat/blat-34-r1.ebuild
new file mode 100644
index 000000000000..c61327420f26
--- /dev/null
+++ b/sci-biology/blat/blat-34-r1.ebuild
@@ -0,0 +1,45 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+MY_PN="${PN}Src"
+
+DESCRIPTION="The BLAST-Like Alignment Tool, a fast genomic sequence aligner"
+HOMEPAGE="http://www.cse.ucsc.edu/~kent/"
+SRC_URI="http://www.soe.ucsc.edu/~kent/src/${MY_PN}${PV}.zip"
+
+SLOT="0"
+LICENSE="blat"
+KEYWORDS="~amd64 ~x86 ~x64-macos"
+IUSE=""
+
+S="${WORKDIR}/${MY_PN}"
+
+DEPEND="app-arch/unzip"
+RDEPEND=""
+
+src_prepare() {
+ epatch "${FILESDIR}"/${PV}-gentoo.patch
+ sed \
+ -e "1i\CFLAGS=${CFLAGS}" \
+ -e "1i\LDFLAGS=${LDFLAGS}" \
+ -i inc/common.mk || die
+ tc-export CC
+}
+
+src_compile() {
+ MACHTYPE=$(tc-arch)
+ [[ ${MACHTYPE} == "x86" ]] && MACHTYPE="i386"
+ mkdir -p "${S}/bin/${MACHTYPE}"
+ emake MACHTYPE="${MACHTYPE}" HOME="${S}" LDFLAGS="${LDFLAGS}"
+}
+
+src_install() {
+ MACHTYPE=$(tc-arch)
+ [[ ${MACHTYPE} == "x86" ]] && MACHTYPE="i386"
+ dobin "${S}/bin/${MACHTYPE}/"*
+}
diff --git a/sci-biology/blat/blat-34.ebuild b/sci-biology/blat/blat-34.ebuild
new file mode 100644
index 000000000000..41d48bf26bd3
--- /dev/null
+++ b/sci-biology/blat/blat-34.ebuild
@@ -0,0 +1,34 @@
+# Copyright 1999-2009 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+inherit toolchain-funcs
+
+DESCRIPTION="The BLAST-Like Alignment Tool, a fast genomic sequence aligner"
+LICENSE="blat"
+HOMEPAGE="http://www.cse.ucsc.edu/~kent/"
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 x86"
+
+MY_PN="${PN}Src"
+SRC_URI="http://www.soe.ucsc.edu/~kent/src/${MY_PN}${PV}.zip"
+S="${WORKDIR}/${MY_PN}"
+
+DEPEND="app-arch/unzip"
+RDEPEND=""
+
+src_compile() {
+ MACHTYPE=$(tc-arch)
+ [[ ${MACHTYPE} == "x86" ]] && MACHTYPE="i386"
+ sed -i 's/-Werror//; s/CFLAGS=//;' "${S}/inc/common.mk"
+ sed -i 's/\(${STRIP} \)/#\1/' "${S}"/{*/makefile,utils/*/makefile,*/*.mk}
+ mkdir -p "${S}/bin/${MACHTYPE}"
+ emake MACHTYPE="${MACHTYPE}" HOME="${S}" || die "emake failed"
+}
+
+src_install() {
+ MACHTYPE=$(tc-arch)
+ [[ ${MACHTYPE} == "x86" ]] && MACHTYPE="i386"
+ dobin "${S}/bin/${MACHTYPE}/"*
+}
diff --git a/sci-biology/blat/files/34-gentoo.patch b/sci-biology/blat/files/34-gentoo.patch
new file mode 100644
index 000000000000..8bdd05bff68d
--- /dev/null
+++ b/sci-biology/blat/files/34-gentoo.patch
@@ -0,0 +1,226 @@
+ blat/makefile | 2 +-
+ gfClient/makefile | 2 +-
+ gfServer/makefile | 2 +-
+ hg/pslPretty/makefile | 2 +-
+ hg/pslReps/makefile | 2 +-
+ hg/pslSort/makefile | 2 +-
+ inc/common.mk | 11 +++--------
+ makefile | 28 ++++++++++++++--------------
+ utils/faToNib/makefile | 2 +-
+ utils/faToTwoBit/makefile | 2 +-
+ utils/nibFrag/makefile | 2 +-
+ utils/twoBitInfo/makefile | 2 +-
+ utils/twoBitToFa/makefile | 2 +-
+ 13 files changed, 28 insertions(+), 33 deletions(-)
+
+diff --git a/blat/makefile b/blat/makefile
+index b889c7b..739503a 100644
+--- a/blat/makefile
++++ b/blat/makefile
+@@ -7,7 +7,7 @@ MYLIBS = $(MYLIBDIR)/jkOwnLib.a $(MYLIBDIR)/jkweb.a
+ O = blat.o
+
+ blat: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/blat $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/blat $O $(MYLIBS) $L
+ ${STRIP} ${BINDIR}/blat${EXE}
+
+ all:
+diff --git a/gfClient/makefile b/gfClient/makefile
+index c3288de..36e957e 100644
+--- a/gfClient/makefile
++++ b/gfClient/makefile
+@@ -8,5 +8,5 @@ O = gfClient.o
+ X = gfClient
+
+ gfClient: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/$X $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/$X $O $(MYLIBS) $L
+ ${STRIP} ${BINDIR}/$X${EXE}
+diff --git a/gfServer/makefile b/gfServer/makefile
+index c06b3a5..f042d22 100644
+--- a/gfServer/makefile
++++ b/gfServer/makefile
+@@ -8,7 +8,7 @@ O = gfServer.o
+ X = gfServer
+
+ gfServer: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/$X $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/$X $O $(MYLIBS) $L
+ ${STRIP} ${BINDIR}/$X${EXE}
+
+ test:
+diff --git a/hg/pslPretty/makefile b/hg/pslPretty/makefile
+index c780b96..cbbcd0d 100644
+--- a/hg/pslPretty/makefile
++++ b/hg/pslPretty/makefile
+@@ -8,7 +8,7 @@ MYLIBS = $(MYLIBDIR)/jkweb.a
+ O = pslPretty.o
+
+ pslPretty: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/pslPretty $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/pslPretty $O $(MYLIBS) $L
+
+ test:: testRna testDnax
+
+diff --git a/hg/pslReps/makefile b/hg/pslReps/makefile
+index 6e8f6d7..2b73b60 100644
+--- a/hg/pslReps/makefile
++++ b/hg/pslReps/makefile
+@@ -9,7 +9,7 @@ MYLIBS = $(MYLIBDIR)/jkweb.a
+ O = pslReps.o
+
+ pslReps: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/pslReps${EXE} $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/pslReps${EXE} $O $(MYLIBS) $L
+
+ lib:
+ cd ../../lib && ${MAKE}
+diff --git a/hg/pslSort/makefile b/hg/pslSort/makefile
+index 81fe083..eb63257 100644
+--- a/hg/pslSort/makefile
++++ b/hg/pslSort/makefile
+@@ -8,7 +8,7 @@ MYLIBS = $(MYLIBDIR)/jkweb.a
+ O = pslSort.o
+
+ pslSort: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/pslSort $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/pslSort $O $(MYLIBS) $L
+
+
+ lib:
+diff --git a/inc/common.mk b/inc/common.mk
+index 1823163..3a04e2b 100644
+--- a/inc/common.mk
++++ b/inc/common.mk
+@@ -1,20 +1,15 @@
+-CC=gcc
+-ifeq (${COPT},)
+- COPT=-O
+-endif
+-CFLAGS=
+ HG_DEFS=-D_FILE_OFFSET_BITS=64 -D_LARGEFILE_SOURCE -D_GNU_SOURCE -DMACHTYPE_${MACHTYPE}
+ HG_WARN=-Wformat -Wimplicit -Wuninitialized -Wreturn-type
+ HG_INC=-I../inc -I../../inc -I../../../inc -I../../../../inc -I../../../../../inc
+
+ # Stronger warning checks, and warnings-->errors, for libraries and CGIs:
+ ifeq (darwin,$(findstring darwin,${OSTYPE}))
+- HG_WARN_ERR = -DJK_WARN -Wall -Werror -Wno-unused-variable
++ HG_WARN_ERR = -DJK_WARN -Wall -Wno-unused-variable
+ else
+ ifeq (solaris,$(findstring solaris,${OSTYPE}))
+ HG_WARN_ERR = -DJK_WARN -Wall
+ else
+- HG_WARN_ERR = -DJK_WARN -Wall -Werror
++ HG_WARN_ERR = -DJK_WARN -Wall
+ endif
+ endif
+ # Apply the stronger checks to all code on our development machine:
+@@ -37,7 +32,7 @@ ifeq (${BINDIR},)
+ endif
+ MKDIR=mkdir -p
+ ifeq (${STRIP},)
+- STRIP=strip
++ STRIP=true
+ endif
+ CVS=cvs
+
+diff --git a/makefile b/makefile
+index 6f9fddf..dded1cd 100644
+--- a/makefile
++++ b/makefile
+@@ -1,18 +1,18 @@
+ all:
+- cd lib && ${MAKE}
+- cd jkOwnLib && ${MAKE}
+- cd blat && $(MAKE)
+- cd gfClient && $(MAKE)
+- cd gfServer && $(MAKE)
+- cd hg/pslPretty && $(MAKE)
+- cd hg/pslReps && $(MAKE)
+- cd hg/pslSort && $(MAKE)
+- cd utils/nibFrag && $(MAKE)
+- cd utils/faToNib && $(MAKE)
+- cd utils/faToTwoBit && $(MAKE)
+- cd utils/twoBitToFa && $(MAKE)
+- cd utils/twoBitInfo && $(MAKE)
+- cd webBlat && $(MAKE)
++ $(MAKE) -C lib
++ $(MAKE) -C jkOwnLib
++ $(MAKE) -C blat
++ $(MAKE) -C gfClient
++ $(MAKE) -C gfServer
++ $(MAKE) -C hg/pslPretty
++ $(MAKE) -C hg/pslReps
++ $(MAKE) -C hg/pslSort
++ $(MAKE) -C utils/nibFrag
++ $(MAKE) -C utils/faToNib
++ $(MAKE) -C utils/faToTwoBit
++ $(MAKE) -C utils/twoBitToFa
++ $(MAKE) -C utils/twoBitInfo
++ $(MAKE) -C webBlat
+
+ clean:
+ rm -f */*.o */*/*.o
+diff --git a/utils/faToNib/makefile b/utils/faToNib/makefile
+index fd0e3eb..63a1593 100644
+--- a/utils/faToNib/makefile
++++ b/utils/faToNib/makefile
+@@ -8,4 +8,4 @@ MYLIBS = $(MYLIBDIR)/jkweb.a
+ O = faToNib.o
+
+ faToNib: $O $(MYLIBS)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/faToNib $O $(MYLIBS) $L
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/faToNib $O $(MYLIBS) $L
+diff --git a/utils/faToTwoBit/makefile b/utils/faToTwoBit/makefile
+index b1b44a9..1e8c1c8 100644
+--- a/utils/faToTwoBit/makefile
++++ b/utils/faToTwoBit/makefile
+@@ -7,7 +7,7 @@ MYLIBS = ${MYLIBDIR}/jkweb.a
+ O = faToTwoBit.o
+
+ faToTwoBit: $O ${MYLIBS}
+- ${CC} ${COPT} -o ${BINDIR}/faToTwoBit $O ${MYLIBS} $L
++ ${CC} ${COPT} ${LDFLAGS} -o ${BINDIR}/faToTwoBit $O ${MYLIBS} $L
+ ${STRIP} ${BINDIR}/faToTwoBit${EXE}
+
+ clean:
+diff --git a/utils/nibFrag/makefile b/utils/nibFrag/makefile
+index 260a6f3..e37b9ab 100755
+--- a/utils/nibFrag/makefile
++++ b/utils/nibFrag/makefile
+@@ -4,7 +4,7 @@ include ../../inc/common.mk
+ O = nibFrag.o
+
+ nibFrag: $(O)
+- ${CC} ${COPT} ${CFLAGS} -o ${BINDIR}/nibFrag $O ../../lib/$(MACHTYPE)/jkweb.a
++ ${CC} ${COPT} ${CFLAGS} ${LDFLAGS} -o ${BINDIR}/nibFrag $O ../../lib/$(MACHTYPE)/jkweb.a
+
+
+
+diff --git a/utils/twoBitInfo/makefile b/utils/twoBitInfo/makefile
+index 649784f..9434d1c 100644
+--- a/utils/twoBitInfo/makefile
++++ b/utils/twoBitInfo/makefile
+@@ -7,7 +7,7 @@ MYLIBS = ${MYLIBDIR}/jkweb.a
+ O = twoBitInfo.o
+
+ twoBitInfo: $O ${MYLIBS}
+- ${CC} ${COPT} -o ${BINDIR}/twoBitInfo $O ${MYLIBS} $L
++ ${CC} ${COPT} ${LDFLAGS} -o ${BINDIR}/twoBitInfo $O ${MYLIBS} $L
+ ${STRIP} ${BINDIR}/twoBitInfo${EXE}
+
+ clean:
+diff --git a/utils/twoBitToFa/makefile b/utils/twoBitToFa/makefile
+index cf979f2..081f3b8 100644
+--- a/utils/twoBitToFa/makefile
++++ b/utils/twoBitToFa/makefile
+@@ -8,7 +8,7 @@ MYLIBS = ${MYLIBDIR}/jkweb.a
+ O = twoBitToFa.o
+
+ twoBitToFa: $O ${MYLIBS}
+- ${CC} ${COPT} -o ${BINDIR}/twoBitToFa $O ${MYLIBS} $L
++ ${CC} ${COPT} ${LDFLAGS} -o ${BINDIR}/twoBitToFa $O ${MYLIBS} $L
+ #${STRIP} ${BINDIR}/twoBitToFa${EXE}
+
+ clean:
diff --git a/sci-biology/blat/metadata.xml b/sci-biology/blat/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/blat/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/blossoc/Manifest b/sci-biology/blossoc/Manifest
new file mode 100644
index 000000000000..96859ca6bf5f
--- /dev/null
+++ b/sci-biology/blossoc/Manifest
@@ -0,0 +1 @@
+DIST blossoc-1.4.0.tar.gz 194885 SHA256 b23f51349f72f31263b8aca162c7590a5f52b72fd5e0d91b4a2591098ff5bdbe
diff --git a/sci-biology/blossoc/blossoc-1.4.0.ebuild b/sci-biology/blossoc/blossoc-1.4.0.ebuild
new file mode 100644
index 000000000000..7e5b6694d395
--- /dev/null
+++ b/sci-biology/blossoc/blossoc-1.4.0.ebuild
@@ -0,0 +1,31 @@
+# Copyright 1999-2010 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="2"
+
+inherit autotools eutils
+
+DESCRIPTION="A linkage disequilibrium association mapping tool"
+HOMEPAGE="http://www.daimi.au.dk/~mailund/Blossoc/"
+SRC_URI="http://www.daimi.au.dk/~mailund/Blossoc/download/${P}.tar.gz"
+
+LICENSE="GPL-3"
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 x86"
+
+DEPEND="sci-libs/gsl
+ dev-libs/boost
+ sci-biology/snpfile"
+RDEPEND="${DEPEND}"
+
+src_prepare() {
+ sed -i '/TESTS += first_test.sh/ d' "${S}/Makefile.am" || die
+ epatch "${FILESDIR}"/${P}-gcc43.patch
+ eautoreconf
+}
+
+src_install() {
+ emake install DESTDIR="${D}" || die "emake install failed"
+}
diff --git a/sci-biology/blossoc/files/blossoc-1.4.0-gcc43.patch b/sci-biology/blossoc/files/blossoc-1.4.0-gcc43.patch
new file mode 100644
index 000000000000..d8e354c1745f
--- /dev/null
+++ b/sci-biology/blossoc/files/blossoc-1.4.0-gcc43.patch
@@ -0,0 +1,15 @@
+Fixes build with >=GCC-4.3
+
+http://bugs.gentoo.org/show_bug.cgi?id=292949
+
+Patch written by Sebastian Luther <SebastianLuther@gmx.de>
+--- pph.cc
++++ pph.cc
+@@ -23,6 +23,7 @@
+ */
+
+ #include "pph.hh"
++#include <cstdio>
+ #include <cmath>
+ #include <snpfile/matrix.hh>
+ using namespace BiRC::SNPFile;
diff --git a/sci-biology/blossoc/metadata.xml b/sci-biology/blossoc/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/blossoc/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/bowtie/Manifest b/sci-biology/bowtie/Manifest
new file mode 100644
index 000000000000..1345a9e07e4e
--- /dev/null
+++ b/sci-biology/bowtie/Manifest
@@ -0,0 +1,2 @@
+DIST bowtie-0.12.8-src.zip 15569919 SHA256 f074a0f25e156976c4951fd69651d60caab925af9829054d107ec8b19af3082d SHA512 824eddd7db24177f7e15b90fb93a0426c2b8cee4dbcac2707f4cc7e7e42bafcad3775382b79d9b4d679e0c4b5c17a1b79ad134e91a968037336b34c6262e9c48 WHIRLPOOL 7056444822e7a0de619dcab933a7870ebe7db52008f3dbb2dd72aa189325d7ca4c353133d77150ec67c414e005a834458538f57746b13fd20f06bc7289869800
+DIST bowtie-1.0.0-src.zip 7710572 SHA256 51e434a78e053301f82ae56f4e94f71f97b19f7175324777a7305c8f88c5bac5 SHA512 d867a61c9d4caa2fbe8161b93acc9ccf04294055796a82ccf8d6456019e97299d90d9f16492f873606ae394bbc735108fc97ddf4e5d576a7376f3f9744118831 WHIRLPOOL a70d6516db8ee0c8838795e3b1df0ae1986342cee5dcafd80a39b06cb07ece79d7ebfc6e88b36625d9b33f4f42f559364f42dd4d881fd729c27eac9e673951a1
diff --git a/sci-biology/bowtie/bowtie-0.12.8.ebuild b/sci-biology/bowtie/bowtie-0.12.8.ebuild
new file mode 100644
index 000000000000..c26c986ed194
--- /dev/null
+++ b/sci-biology/bowtie/bowtie-0.12.8.ebuild
@@ -0,0 +1,44 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="An ultrafast memory-efficient short read aligner"
+HOMEPAGE="http://bowtie-bio.sourceforge.net/"
+SRC_URI="mirror://sourceforge/bowtie-bio/${P}-src.zip"
+
+LICENSE="Artistic"
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 x86 ~x64-macos"
+
+DEPEND="app-arch/unzip"
+RDEPEND=""
+
+# NB: Bundles code from Maq (http://maq.sf.net) and the SeqAn library (http://www.seqan.de)
+# TODO: properly report system CFLAGS in -DCOMPILE_OPTIONS
+
+src_prepare() {
+ epatch "${FILESDIR}"/${P}-gcc-47.patch
+}
+
+src_compile() {
+ unset CFLAGS
+ emake \
+ CC="$(tc-getCC)" \
+ CPP="$(tc-getCXX)" \
+ CXX="$(tc-getCXX)" \
+ EXTRA_FLAGS="${LDFLAGS}" \
+ RELEASE_FLAGS=""
+}
+
+src_install() {
+ dobin bowtie bowtie-*
+ exeinto /usr/share/${PN}/scripts
+ doexe scripts/*
+ newman MANUAL bowtie.1
+ dodoc AUTHORS NEWS TUTORIAL
+}
diff --git a/sci-biology/bowtie/bowtie-1.0.0.ebuild b/sci-biology/bowtie/bowtie-1.0.0.ebuild
new file mode 100644
index 000000000000..b8181190243c
--- /dev/null
+++ b/sci-biology/bowtie/bowtie-1.0.0.ebuild
@@ -0,0 +1,42 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="An ultrafast memory-efficient short read aligner"
+HOMEPAGE="http://bowtie-bio.sourceforge.net/"
+SRC_URI="mirror://sourceforge/bowtie-bio/${P}-src.zip"
+
+LICENSE="Artistic"
+SLOT="0"
+IUSE=""
+KEYWORDS="~amd64 ~x86 ~x64-macos"
+
+DEPEND="app-arch/unzip"
+RDEPEND=""
+
+src_compile() {
+ unset CFLAGS
+ emake \
+ CC="$(tc-getCC)" \
+ CPP="$(tc-getCXX)" \
+ CXX="$(tc-getCXX)" \
+ EXTRA_FLAGS="${LDFLAGS}" \
+ RELEASE_FLAGS="${CXXFLAGS}"
+}
+
+src_install() {
+ dobin bowtie bowtie-*
+ exeinto /usr/share/${PN}/scripts
+ doexe scripts/*
+
+ insinto /usr/share/${PN}
+ doins -r genomes indexes
+
+ newman MANUAL bowtie.1
+ dodoc AUTHORS NEWS TUTORIAL doc/README
+ dohtml doc/{manual.html,style.css}
+}
diff --git a/sci-biology/bowtie/files/bowtie-0.12.8-gcc-47.patch b/sci-biology/bowtie/files/bowtie-0.12.8-gcc-47.patch
new file mode 100644
index 000000000000..3c8a1e1d9ca4
--- /dev/null
+++ b/sci-biology/bowtie/files/bowtie-0.12.8-gcc-47.patch
@@ -0,0 +1,45 @@
+ alphabet.h | 24 ++++++++++++------------
+ 1 files changed, 12 insertions(+), 12 deletions(-)
+
+diff --git a/alphabet.h b/alphabet.h
+index b464ddf..08d0281 100644
+--- a/alphabet.h
++++ b/alphabet.h
+@@ -38,6 +38,18 @@ static inline TStr reverseComplement(const TStr& s, bool color) {
+ return s_rc;
+ }
+
++/// Reverse a string in-place
++template <typename TStr>
++static inline void reverseInPlace(TStr& s) {
++ typedef typename Value<TStr>::Type TVal;
++ size_t len = length(s);
++ for(size_t i = 0; i < (len>>1); i++) {
++ TVal tmp = s[i];
++ s[i] = s[len-i-1];
++ s[len-i-1] = tmp;
++ }
++}
++
+ /**
+ * Reverse-complement s in-place. Ns go to Ns.
+ */
+@@ -69,18 +81,6 @@ static inline void reverseComplementInPlace(TStr& s, bool color) {
+ }
+ }
+
+-/// Reverse a string in-place
+-template <typename TStr>
+-static inline void reverseInPlace(TStr& s) {
+- typedef typename Value<TStr>::Type TVal;
+- size_t len = length(s);
+- for(size_t i = 0; i < (len>>1); i++) {
+- TVal tmp = s[i];
+- s[i] = s[len-i-1];
+- s[len-i-1] = tmp;
+- }
+-}
+-
+ /**
+ * Return the reverse-complement of s.
+ */
diff --git a/sci-biology/bowtie/metadata.xml b/sci-biology/bowtie/metadata.xml
new file mode 100644
index 000000000000..e493417070fb
--- /dev/null
+++ b/sci-biology/bowtie/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="sourceforge">bowtie-bio</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/bwa/Manifest b/sci-biology/bwa/Manifest
new file mode 100644
index 000000000000..9c0d995bfb1f
--- /dev/null
+++ b/sci-biology/bwa/Manifest
@@ -0,0 +1 @@
+DIST bwa-0.7.12.tar.bz2 184599 SHA256 701dcad147ae470d741717a72c369b338df7f80bff4bb8eee8176c66f16d608c SHA512 3ea093b861c1596d20b1ee0336468b66e52bc9f26e3d0bcbba0ddccc7fe9b1af2c7e1ed2a4e1366fe93fec348152becc126d5f4685dae54f05e6c582488b3abd WHIRLPOOL 4b8651dedf2e09980850e7212fc2a77dc86b06f708af2077cff28cc843858b15825a203e3e02e7728418e9eb539004404f7c4b234c1f65de6a7b7dfe4dcfd1d0
diff --git a/sci-biology/bwa/bwa-0.7.12.ebuild b/sci-biology/bwa/bwa-0.7.12.ebuild
new file mode 100644
index 000000000000..76ed0cca912b
--- /dev/null
+++ b/sci-biology/bwa/bwa-0.7.12.ebuild
@@ -0,0 +1,34 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Burrows-Wheeler Alignment Tool, a fast short genomic sequence aligner"
+HOMEPAGE="http://bio-bwa.sourceforge.net/"
+SRC_URI="mirror://sourceforge/bio-bwa/${P}.tar.bz2"
+
+LICENSE="GPL-3"
+SLOT="0"
+IUSE=""
+KEYWORDS="amd64 x86 ~x64-macos"
+
+PATCHES=( "${FILESDIR}"/${P}-Makefile.patch )
+
+src_prepare() {
+ epatch ${PATCHES[@]}
+ tc-export CC AR
+}
+
+src_install() {
+ dobin bwa
+
+ doman bwa.1
+
+ exeinto /usr/libexec/${PN}
+ doexe qualfa2fq.pl xa2multi.pl
+
+ dodoc NEWS.md README-alt.md README.md
+}
diff --git a/sci-biology/bwa/files/bwa-0.7.12-Makefile.patch b/sci-biology/bwa/files/bwa-0.7.12-Makefile.patch
new file mode 100644
index 000000000000..406e9b052376
--- /dev/null
+++ b/sci-biology/bwa/files/bwa-0.7.12-Makefile.patch
@@ -0,0 +1,27 @@
+--- Makefile
++++ Makefile
+@@ -1,8 +1,8 @@
+-CC= gcc
++CC?= gcc
+ #CC= clang --analyze
+-CFLAGS= -g -Wall -Wno-unused-function -O2
++CFLAGS?= -g -Wall -Wno-unused-function -O2
+ WRAP_MALLOC=-DUSE_MALLOC_WRAPPERS
+-AR= ar
++AR?= ar
+ DFLAGS= -DHAVE_PTHREAD $(WRAP_MALLOC)
+ LOBJS= utils.o kthread.o kstring.o ksw.o bwt.o bntseq.o bwa.o bwamem.o bwamem_pair.o bwamem_extra.o malloc_wrap.o
+ AOBJS= QSufSort.o bwt_gen.o bwashm.o bwase.o bwaseqio.o bwtgap.o bwtaln.o bamlite.o \
+@@ -26,10 +26,10 @@
+ all:$(PROG)
+
+ bwa:libbwa.a $(AOBJS) main.o
+- $(CC) $(CFLAGS) $(DFLAGS) $(AOBJS) main.o -o $@ -L. -lbwa $(LIBS)
++ $(CC) $(CFLAGS) $(LDFLAGS) $(DFLAGS) $(AOBJS) main.o -o $@ -L. -lbwa $(LIBS)
+
+ bwamem-lite:libbwa.a example.o
+- $(CC) $(CFLAGS) $(DFLAGS) example.o -o $@ -L. -lbwa $(LIBS)
++ $(CC) $(CFLAGS) $(LDFLAGS) $(DFLAGS) example.o -o $@ -L. -lbwa $(LIBS)
+
+ libbwa.a:$(LOBJS)
+ $(AR) -csru $@ $(LOBJS)
diff --git a/sci-biology/bwa/metadata.xml b/sci-biology/bwa/metadata.xml
new file mode 100644
index 000000000000..97a33fbf5c42
--- /dev/null
+++ b/sci-biology/bwa/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="sourceforge">bio-bwa</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/cd-hit/Manifest b/sci-biology/cd-hit/Manifest
new file mode 100644
index 000000000000..c3cf3842c604
--- /dev/null
+++ b/sci-biology/cd-hit/Manifest
@@ -0,0 +1,3 @@
+DIST cd-hit-v4.5.1-2011-01-31.tgz 368740 RMD160 118a37f44795db666cb9c6b53a5d29f4e72b73cb SHA1 5cd6e51390a7cee860fe97a51480d28f49bdcf61 SHA256 c1c3a3a772fc683fec3ff1763fdeec62a0a2a3925124f7a723fe3b271da35281
+DIST cd-hit-v4.5.4-2011-03-07.tgz 370264 RMD160 00fca8d2527a4a6b1eda861f8f750e10ee565ae7 SHA1 743c4b6ec79b9d5acd1e1171587e96c03e3e3003 SHA256 6de9074fada3c5f8109b670b8bdf96679dab45b841d36270d6c5e61a34284f6a
+DIST cd-hit-v4.6-2012-04-25.tgz 652228 RMD160 318239a9416fd3cd57754546c8fcc0a4cea7f5d8 SHA1 e47c662c0a284ae99e47205d6a4eaea805a76cae SHA256 aa91e57bba61f04db39e83cdd6c8cdf082a006ea8c4c818b956b7531e4bcc2e9
diff --git a/sci-biology/cd-hit/cd-hit-4.5.1.ebuild b/sci-biology/cd-hit/cd-hit-4.5.1.ebuild
new file mode 100644
index 000000000000..d47948f0d821
--- /dev/null
+++ b/sci-biology/cd-hit/cd-hit-4.5.1.ebuild
@@ -0,0 +1,42 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=3
+
+inherit eutils flag-o-matic toolchain-funcs
+
+RELDATE="2011-01-31"
+RELEASE="${PN}-v${PV}-${RELDATE}"
+
+DESCRIPTION="Clustering Database at High Identity with Tolerance"
+HOMEPAGE="http://weizhong-lab.ucsd.edu/cd-hit/"
+SRC_URI="http://cdhit.googlecode.com/files/${RELEASE}.tgz"
+
+SLOT="0"
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux"
+LICENSE="GPL-2"
+IUSE="openmp"
+
+S="${WORKDIR}"/${RELEASE}
+
+pkg_setup() {
+ use openmp && ! tc-has-openmp && die "Please switch to an openmp compatible compiler"
+}
+
+src_prepare() {
+ tc-export CXX
+ use openmp || append-flags -DNO_OPENMP
+ epatch "${FILESDIR}"/${PV}-gentoo.patch
+}
+
+src_compile() {
+ local myconf=
+ use openmp && myconf="openmp=yes"
+ emake ${myconf} || die
+}
+
+src_install() {
+ dobin cd-hit cd-hit-est cd-hit-2d cd-hit-est-2d cd-hit-div *.pl || die
+ dodoc ChangeLog cdhit-user-guide.pdf || die
+}
diff --git a/sci-biology/cd-hit/cd-hit-4.5.4.ebuild b/sci-biology/cd-hit/cd-hit-4.5.4.ebuild
new file mode 100644
index 000000000000..bafa3301d724
--- /dev/null
+++ b/sci-biology/cd-hit/cd-hit-4.5.4.ebuild
@@ -0,0 +1,43 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils flag-o-matic toolchain-funcs
+
+RELDATE="2011-03-07"
+RELEASE="${PN}-v${PV}-${RELDATE}"
+
+DESCRIPTION="Clustering Database at High Identity with Tolerance"
+HOMEPAGE="http://weizhong-lab.ucsd.edu/cd-hit/"
+SRC_URI="http://cdhit.googlecode.com/files/${RELEASE}.tgz"
+
+SLOT="0"
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux"
+LICENSE="GPL-2"
+IUSE="openmp"
+
+S="${WORKDIR}"/${RELEASE}
+
+pkg_setup() {
+ use openmp && ! tc-has-openmp && die "Please switch to an openmp compatible compiler"
+}
+
+src_prepare() {
+ tc-export CXX
+ use openmp || append-flags -DNO_OPENMP
+ epatch "${FILESDIR}"/${PV}-gentoo.patch
+}
+
+src_compile() {
+ local myconf=
+ use openmp && myconf="openmp=yes"
+ emake ${myconf}
+}
+
+src_install() {
+ dodir /usr/bin
+ emake PREFIX="${ED}/usr/bin" install
+ dodoc ChangeLog cdhit-user-guide.pdf
+}
diff --git a/sci-biology/cd-hit/cd-hit-4.6.ebuild b/sci-biology/cd-hit/cd-hit-4.6.ebuild
new file mode 100644
index 000000000000..d7dd15559c5c
--- /dev/null
+++ b/sci-biology/cd-hit/cd-hit-4.6.ebuild
@@ -0,0 +1,44 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils flag-o-matic toolchain-funcs
+
+RELDATE="2012-04-25"
+RELEASE="${PN}-v${PV}-${RELDATE}"
+
+DESCRIPTION="Clustering Database at High Identity with Tolerance"
+HOMEPAGE="http://weizhong-lab.ucsd.edu/cd-hit/"
+SRC_URI="http://cdhit.googlecode.com/files/${RELEASE}.tgz"
+
+SLOT="0"
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux"
+LICENSE="GPL-2"
+IUSE="doc openmp"
+
+S="${WORKDIR}"/${RELEASE}
+
+pkg_setup() {
+ use openmp && ! tc-has-openmp && die "Please switch to an openmp compatible compiler"
+}
+
+src_prepare() {
+ tc-export CXX
+ use openmp || append-flags -DNO_OPENMP
+ epatch "${FILESDIR}"/${PV}-gentoo.patch
+}
+
+src_compile() {
+ local myconf=
+ use openmp && myconf="openmp=yes"
+ emake ${myconf}
+}
+
+src_install() {
+ dodir /usr/bin
+ emake PREFIX="${ED}/usr/bin" install
+ dodoc ChangeLog
+ use doc && dodoc doc/*
+}
diff --git a/sci-biology/cd-hit/files/4.5.1-gentoo.patch b/sci-biology/cd-hit/files/4.5.1-gentoo.patch
new file mode 100644
index 000000000000..c3eaf79cc8f2
--- /dev/null
+++ b/sci-biology/cd-hit/files/4.5.1-gentoo.patch
@@ -0,0 +1,85 @@
+diff --git a/Makefile b/Makefile
+index f1eaa26..92d3130 100644
+--- a/Makefile
++++ b/Makefile
+@@ -10,7 +10,7 @@ CCFLAGS = -O2 -DNO_OPENMP
+ # in command line:
+ # make openmp=yes
+ ifeq ($(openmp),yes)
+-CCFLAGS = -O2 -fopenmp
++CXXFLAGS += -fopenmp
+ endif
+
+ # support debugging
+@@ -18,16 +18,16 @@ endif
+ # make debug=yes
+ # make openmp=yes debug=yes
+ ifeq ($(debug),yes)
+-CCFLAGS += -ggdb
++CXXFLAGS += -ggdb
+ endif
+
+ #LDFLAGS = -static -o
+-LDFLAGS = -o
++LDFLAGS += -o
+
+ PROGS = cd-hit cd-hit-est cd-hit-2d cd-hit-est-2d cd-hit-div
+
+ .c++.o:
+- $(CC) $(CCFLAGS) -c $<
++ $(CXX) $(CXXFLAGS) -c $<
+
+ all: $(PROGS)
+
+@@ -37,39 +37,39 @@ clean:
+ # programs
+
+ cd-hit: cdhit-common.o cdhit-utility.o cdhit.o
+- $(CC) $(CCFLAGS) cdhit.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit
++ $(CXX) $(CXXFLAGS) cdhit.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit
+
+ cd-hit-2d: cdhit-common.o cdhit-utility.o cdhit-2d.o
+- $(CC) $(CCFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-2d
++ $(CXX) $(CXXFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-2d
+
+ cd-hit-est: cdhit-common.o cdhit-utility.o cdhit-est.o
+- $(CC) $(CCFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est
++ $(CXX) $(CXXFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est
+
+ cd-hit-est-2d: cdhit-common.o cdhit-utility.o cdhit-est-2d.o
+- $(CC) $(CCFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est-2d
++ $(CXX) $(CXXFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est-2d
+
+ cd-hit-div: cdhit-common.o cdhit-utility.o cdhit-div.o
+- $(CC) $(CCFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-div
++ $(CXX) $(CXXFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-div
+
+ # objects
+ cdhit-common.o: cdhit-common.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-common.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-common.c++ -c
+
+ cdhit-utility.o: cdhit-utility.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-utility.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-utility.c++ -c
+
+ cdhit.o: cdhit.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit.c++ -c
+
+ cdhit-2d.o: cdhit-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-2d.c++ -c
+
+ cdhit-est.o: cdhit-est.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est.c++ -c
+
+ cdhit-est-2d.o: cdhit-est-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est-2d.c++ -c
+
+ cdhit-div.o: cdhit-div.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-div.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-div.c++ -c
+
diff --git a/sci-biology/cd-hit/files/4.5.4-gentoo.patch b/sci-biology/cd-hit/files/4.5.4-gentoo.patch
new file mode 100644
index 000000000000..5aa9b79e02ae
--- /dev/null
+++ b/sci-biology/cd-hit/files/4.5.4-gentoo.patch
@@ -0,0 +1,98 @@
+ Makefile | 36 ++++++++++++++++++------------------
+ 1 files changed, 18 insertions(+), 18 deletions(-)
+
+diff --git a/Makefile b/Makefile
+index e8bac1d..bd31093 100644
+--- a/Makefile
++++ b/Makefile
+@@ -10,7 +10,7 @@ CCFLAGS = -O2 -DNO_OPENMP
+ # in command line:
+ # make openmp=yes
+ ifeq ($(openmp),yes)
+-CCFLAGS = -O2 -fopenmp
++CXXFLAGS += -fopenmp
+ endif
+
+ # support debugging
+@@ -18,16 +18,16 @@ endif
+ # make debug=yes
+ # make openmp=yes debug=yes
+ ifeq ($(debug),yes)
+-CCFLAGS += -ggdb
++CXXFLAGS += -ggdb
+ endif
+
+ #LDFLAGS = -static -o
+-LDFLAGS = -o
++LDFLAGS += -o
+
+ PROGS = cd-hit cd-hit-est cd-hit-2d cd-hit-est-2d cd-hit-div cd-hit-454
+
+ .c++.o:
+- $(CC) $(CCFLAGS) -c $<
++ $(CXX) $(CXXFLAGS) -c $<
+
+ all: $(PROGS)
+
+@@ -37,47 +37,47 @@ clean:
+ # programs
+
+ cd-hit: cdhit-common.o cdhit-utility.o cdhit.o
+- $(CC) $(CCFLAGS) cdhit.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit
++ $(CXX) $(CXXFLAGS) cdhit.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit
+
+ cd-hit-2d: cdhit-common.o cdhit-utility.o cdhit-2d.o
+- $(CC) $(CCFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-2d
++ $(CXX) $(CXXFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-2d
+
+ cd-hit-est: cdhit-common.o cdhit-utility.o cdhit-est.o
+- $(CC) $(CCFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est
++ $(CXX) $(CXXFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est
+
+ cd-hit-est-2d: cdhit-common.o cdhit-utility.o cdhit-est-2d.o
+- $(CC) $(CCFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est-2d
++ $(CXX) $(CXXFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est-2d
+
+ cd-hit-div: cdhit-common.o cdhit-utility.o cdhit-div.o
+- $(CC) $(CCFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-div
++ $(CXX) $(CXXFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-div
+
+ cd-hit-454: cdhit-common.o cdhit-utility.o cdhit-454.o
+- $(CC) $(CCFLAGS) cdhit-454.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-454
++ $(CXX) $(CXXFLAGS) cdhit-454.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-454
+
+ # objects
+ cdhit-common.o: cdhit-common.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-common.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-common.c++ -c
+
+ cdhit-utility.o: cdhit-utility.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-utility.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-utility.c++ -c
+
+ cdhit.o: cdhit.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit.c++ -c
+
+ cdhit-2d.o: cdhit-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-2d.c++ -c
+
+ cdhit-est.o: cdhit-est.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est.c++ -c
+
+ cdhit-est-2d.o: cdhit-est-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est-2d.c++ -c
+
+ cdhit-div.o: cdhit-div.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-div.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-div.c++ -c
+
+ cdhit-454.o: cdhit-454.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-454.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-454.c++ -c
+
+ PREFIX ?= /usr/local/bin
+
diff --git a/sci-biology/cd-hit/files/4.6-gentoo.patch b/sci-biology/cd-hit/files/4.6-gentoo.patch
new file mode 100644
index 000000000000..7a376eb8e73c
--- /dev/null
+++ b/sci-biology/cd-hit/files/4.6-gentoo.patch
@@ -0,0 +1,117 @@
+ Makefile | 47 ++++++++++++++++++++++-------------------------
+ 1 files changed, 22 insertions(+), 25 deletions(-)
+
+diff --git a/Makefile b/Makefile
+index e9796a1..97dd72b 100644
+--- a/Makefile
++++ b/Makefile
+@@ -1,16 +1,13 @@
+-
+-CC = g++ -Wall -ggdb
+-CC = g++ -pg
+-CC = g++
++CXX ?= g++
+
+ # without OpenMP
+-CCFLAGS = -DNO_OPENMP
++#CXXFLAGS = -DNO_OPENMP
+
+ # with OpenMP
+ # in command line:
+ # make openmp=yes
+ ifeq ($(openmp),yes)
+-CCFLAGS = -fopenmp
++CXXFLAGS += -fopenmp
+ endif
+
+ # support debugging
+@@ -18,22 +15,22 @@ endif
+ # make debug=yes
+ # make openmp=yes debug=yes
+ ifeq ($(debug),yes)
+-CCFLAGS += -ggdb
++CXXFLAGS +=
+ else
+-CCFLAGS += -O2
++CXXFLAGS +=
+ endif
+
+ ifdef MAX_SEQ
+-CCFLAGS += -DMAX_SEQ=$(MAX_SEQ)
++CXXFLAGS += -DMAX_SEQ=$(MAX_SEQ)
+ endif
+
+ #LDFLAGS = -static -o
+-LDFLAGS = -o
++#LDFLAGS += -o
+
+ PROGS = cd-hit cd-hit-est cd-hit-2d cd-hit-est-2d cd-hit-div cd-hit-454
+
+ .c++.o:
+- $(CC) $(CCFLAGS) -c $<
++ $(CXX) $(CXXFLAGS) -c $<
+
+ all: $(PROGS)
+
+@@ -43,47 +40,47 @@ clean:
+ # programs
+
+ cd-hit: cdhit-common.o cdhit-utility.o cdhit.o
+- $(CC) $(CCFLAGS) cdhit.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit.o cdhit-common.o cdhit-utility.o -o cd-hit
+
+ cd-hit-2d: cdhit-common.o cdhit-utility.o cdhit-2d.o
+- $(CC) $(CCFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-2d
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit-2d.o cdhit-common.o cdhit-utility.o -o cd-hit-2d
+
+ cd-hit-est: cdhit-common.o cdhit-utility.o cdhit-est.o
+- $(CC) $(CCFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit-est.o cdhit-common.o cdhit-utility.o -o cd-hit-est
+
+ cd-hit-est-2d: cdhit-common.o cdhit-utility.o cdhit-est-2d.o
+- $(CC) $(CCFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-est-2d
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit-est-2d.o cdhit-common.o cdhit-utility.o -o cd-hit-est-2d
+
+ cd-hit-div: cdhit-common.o cdhit-utility.o cdhit-div.o
+- $(CC) $(CCFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-div
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit-div.o cdhit-common.o cdhit-utility.o -o cd-hit-div
+
+ cd-hit-454: cdhit-common.o cdhit-utility.o cdhit-454.o
+- $(CC) $(CCFLAGS) cdhit-454.o cdhit-common.o cdhit-utility.o $(LDFLAGS) cd-hit-454
++ $(CXX) $(CXXFLAGS) $(LDFLAGS) cdhit-454.o cdhit-common.o cdhit-utility.o -o cd-hit-454
+
+ # objects
+ cdhit-common.o: cdhit-common.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-common.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-common.c++ -c
+
+ cdhit-utility.o: cdhit-utility.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-utility.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-utility.c++ -c
+
+ cdhit.o: cdhit.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit.c++ -c
+
+ cdhit-2d.o: cdhit-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-2d.c++ -c
+
+ cdhit-est.o: cdhit-est.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est.c++ -c
+
+ cdhit-est-2d.o: cdhit-est-2d.c++ cdhit-utility.h
+- $(CC) $(CCFLAGS) cdhit-est-2d.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-est-2d.c++ -c
+
+ cdhit-div.o: cdhit-div.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-div.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-div.c++ -c
+
+ cdhit-454.o: cdhit-454.c++ cdhit-common.h
+- $(CC) $(CCFLAGS) cdhit-454.c++ -c
++ $(CXX) $(CXXFLAGS) cdhit-454.c++ -c
+
+ PREFIX ?= /usr/local/bin
+
diff --git a/sci-biology/cd-hit/metadata.xml b/sci-biology/cd-hit/metadata.xml
new file mode 100644
index 000000000000..bd5607ab16b5
--- /dev/null
+++ b/sci-biology/cd-hit/metadata.xml
@@ -0,0 +1,23 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <longdescription>
+CD-HIT is a very widely used program for clustering and comparing large sets
+of protein or nucleotide sequences. CD-HIT is very fast and can handle
+extremely large databases. CD-HIT helps to significantly reduce the
+computational and manual efforts in many sequence analysis tasks and aids in
+understanding the data structure and correct the bias within a dataset.
+The CD-HIT package has CD-HIT, CD-HIT-2D, CD-HIT-EST, CD-HIT-EST-2D,
+CD-HIT-454, CD-HIT-PARA, PSI-CD-HIT and over a dozen scripts. CD-HIT
+(CD-HIT-EST) clusters similar proteins (DNAs) into clusters that meet a
+user-defined similarity threshold. CD-HIT-2D (CD-HIT-EST-2D) compares 2
+datasets and identifies the sequences in db2 that are similar to db1 above
+a threshold. CD-HIT-454 is a program to identify natural and artificial
+duplicates from pyrosequencing reads. The usage of other programs and
+scripts can be found in CD-HIT user's guide.
+</longdescription>
+ <upstream>
+ <remote-id type="google-code">cdhit</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/clustal-omega/Manifest b/sci-biology/clustal-omega/Manifest
new file mode 100644
index 000000000000..2394b3a452f6
--- /dev/null
+++ b/sci-biology/clustal-omega/Manifest
@@ -0,0 +1,2 @@
+DIST clustal-omega-1.2.0.tar.gz 1156741 SHA256 cbf5ad4e1ce88641cca307be1edfe95d3882997d71c11b43c8e1fcd6e388c61d SHA512 d207699e1158178e2d7122620026b199251ab86bcc3f72a08d58f23e2dd5c2961340e872a13c34f1d6832c5eef5ff8ab09c43f0cb51a81d6c4ef554f936434e2 WHIRLPOOL 41505b42829d440fd312f1538ef78fb7d0f668008cd00bcc52022139eb2ff21d05d89519af2a18e5a2f845e24a5d374a81eb4163c2720a32f71ead7ce40e4eac
+DIST clustal-omega-1.2.1.tar.gz 1164492 SHA256 0ef32727aa25c6ecf732083e668a0f45bc17085c28a5c7b4459f4750419f2b0a SHA512 1aa69e319f999f7cd746e2d2ffcafeafc0eb15ed4777abb5b32df63a39a23fa2091977efccfcf9428468103b8e48c4ab0a3ce3967b9c55daaadf3a6a3b57e8de WHIRLPOOL b079dcd659839a85e7772b717ef5dce25b816f2c96eb0f6eea5a4a53f2abd25fb4435291f2a7b739d72d94c06fdbd9c85300ff4cbb03b2861d31d1ad3d196577
diff --git a/sci-biology/clustal-omega/clustal-omega-1.2.0.ebuild b/sci-biology/clustal-omega/clustal-omega-1.2.0.ebuild
new file mode 100644
index 000000000000..ccded19116cd
--- /dev/null
+++ b/sci-biology/clustal-omega/clustal-omega-1.2.0.ebuild
@@ -0,0 +1,38 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils
+
+DESCRIPTION="Scalable multiple alignment of protein sequences"
+HOMEPAGE="http://www.clustal.org/omega/"
+SRC_URI="http://www.clustal.org/omega/${P}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="static-libs"
+
+DEPEND="dev-libs/argtable"
+RDEPEND="${DEPEND}"
+
+AUTOTOOLS_IN_SOURCE_BUILD=1
+
+src_prepare() {
+ sed \
+ -e "s:-O3::g" \
+ -i configure.ac || die
+ autotools-utils_src_prepare
+}
+
+src_install() {
+ autotools-utils_src_install
+ if ! use static-libs; then
+ rm -f "${ED}"/usr/$(get_libdir)/*.a || die
+ rm -fr "${ED}"/usr/$(get_libdir)/pkgconfig || die
+ fi
+}
diff --git a/sci-biology/clustal-omega/clustal-omega-1.2.1.ebuild b/sci-biology/clustal-omega/clustal-omega-1.2.1.ebuild
new file mode 100644
index 000000000000..e56766f9416e
--- /dev/null
+++ b/sci-biology/clustal-omega/clustal-omega-1.2.1.ebuild
@@ -0,0 +1,38 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils
+
+DESCRIPTION="Scalable multiple alignment of protein sequences"
+HOMEPAGE="http://www.clustal.org/omega/"
+SRC_URI="http://www.clustal.org/omega/${P}.tar.gz"
+
+LICENSE="GPL-2"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE="static-libs"
+
+DEPEND="dev-libs/argtable"
+RDEPEND="${DEPEND}"
+
+AUTOTOOLS_IN_SOURCE_BUILD=1
+
+src_prepare() {
+ sed \
+ -e "s:-O3::g" \
+ -i configure.ac || die
+ autotools-utils_src_prepare
+}
+
+src_install() {
+ autotools-utils_src_install
+ if ! use static-libs; then
+ rm -f "${ED}"/usr/$(get_libdir)/*.a || die
+ rm -fr "${ED}"/usr/$(get_libdir)/pkgconfig || die
+ fi
+}
diff --git a/sci-biology/clustal-omega/metadata.xml b/sci-biology/clustal-omega/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/clustal-omega/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/clustalw-mpi/Manifest b/sci-biology/clustalw-mpi/Manifest
new file mode 100644
index 000000000000..b1f7bb630cd0
--- /dev/null
+++ b/sci-biology/clustalw-mpi/Manifest
@@ -0,0 +1 @@
+DIST clustalw-mpi-0.13.tar.gz 154911 RMD160 9da3e418efcb0cfd0c5df2705ee217b9dacc3917 SHA1 ae5026e8b4ba58bb0caa5643ea90434d9589df5a SHA256 2fcb0dc0001b034f2931153654fc66d67db360f0bf3fbcde19dc389bbe145845
diff --git a/sci-biology/clustalw-mpi/clustalw-mpi-0.13-r1.ebuild b/sci-biology/clustalw-mpi/clustalw-mpi-0.13-r1.ebuild
new file mode 100644
index 000000000000..11f1e57e2731
--- /dev/null
+++ b/sci-biology/clustalw-mpi/clustalw-mpi-0.13-r1.ebuild
@@ -0,0 +1,36 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="A parallel (MPI) implemention of the Clustal-W general purpose multiple alignment algorithm"
+HOMEPAGE="http://www.bii.a-star.edu.sg/achievements/applications/clustalw/index.php"
+SRC_URI="http://web.bii.a-star.edu.sg/~kuobin/${PN}/${P}.tar.gz"
+
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+LICENSE="public-domain"
+IUSE="mpi_njtree static_pairalign"
+
+DEPEND="virtual/mpi"
+RDEPEND="${DEPEND}"
+
+src_prepare() {
+ epatch "${FILESDIR}"/${PV}-gentoo.patch
+ if use mpi_njtree; then
+ sed -e "s/TREES_FLAG/#TREES_FLAG/" -i Makefile || \
+ die "Failed to configure MPI code for NJ trees."
+ fi
+ if use static_pairalign; then
+ sed -e "s/DDYNAMIC_SCHEDULING/DSTATIC_SCHEDULING/" -i Makefile || \
+ die "Failed to configure static scheduling for pair alignments."
+ fi
+}
+
+src_install() {
+ dobin ${PN}
+ newdoc README.${PN} README
+}
diff --git a/sci-biology/clustalw-mpi/files/0.13-gentoo.patch b/sci-biology/clustalw-mpi/files/0.13-gentoo.patch
new file mode 100644
index 000000000000..6e36061cbb39
--- /dev/null
+++ b/sci-biology/clustalw-mpi/files/0.13-gentoo.patch
@@ -0,0 +1,23 @@
+ Makefile | 6 +++---
+ 1 files changed, 3 insertions(+), 3 deletions(-)
+
+diff --git a/Makefile b/Makefile
+index f2107ce..835232b 100644
+--- a/Makefile
++++ b/Makefile
+@@ -25,12 +25,12 @@ TREES_FLAG = -DSERIAL_NJTREE
+ PAIRALIGN_FLAG = -DDYNAMIC_SCHEDULING_PAIRALIGN
+ #PAIRALIGN_FLAG = -DSTATIC_SCHEDULING_PAIRALIGN
+
+-CFLAGS = -c -O3
++CFLAGS += -c
+ #CFLAGS = -c -O3 -funroll-all-loops
+-LFLAGS = -lm
++LIBS = -lm
+
+ clustalw-mpi: $(OBJECTS)
+- $(CC) -o $@ $(OBJECTS) $(LFLAGS)
++ $(CC) $(LDFLAGS) -o $@ $(OBJECTS) $(LIBS)
+
+ interface.o : interface.c $(HEADERS) param.h
+ $(CC) $(CFLAGS) $*.c
diff --git a/sci-biology/clustalw-mpi/metadata.xml b/sci-biology/clustalw-mpi/metadata.xml
new file mode 100644
index 000000000000..905eba1a07b8
--- /dev/null
+++ b/sci-biology/clustalw-mpi/metadata.xml
@@ -0,0 +1,11 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+<herd>sci-biology</herd>
+<use>
+ <flag name='mpi_njtree'>Use MPI (as opposed to serial) code for computing
+ neighbor-joining trees</flag>
+ <flag name='static_pairalign'>Use static (as opposed to dynamic) scheduling
+ for pair alignments</flag>
+</use>
+</pkgmetadata>
diff --git a/sci-biology/clustalw/Manifest b/sci-biology/clustalw/Manifest
new file mode 100644
index 000000000000..7d1b7dca8a7f
--- /dev/null
+++ b/sci-biology/clustalw/Manifest
@@ -0,0 +1,2 @@
+DIST clustalw-2.1.tar.gz 350761 SHA256 e052059b87abfd8c9e695c280bfba86a65899138c82abccd5b00478a80f49486 SHA512 659cfe0121015dd2b84578b1a0a7f016fc944de155686b9bdef31122200a21e792203f3a6ab93a31676a50ffb70858b506ceb7ac27d921189a8381dbe0887921 WHIRLPOOL 93158f400cbdf11ecddcac15b5b4cee9af61d9b933f7100ad18d01d346de54c6bad5a9a12fe5a70a265c92581d3ee9cfbc41b17ee2c2ff80ff2a6658efba5f40
+DIST clustalw1.83.UNIX.tar.gz 166863 SHA256 8b757e02ae95ac0a0dd37db640497aa90f7a13a11784ce2a17f41b64e3059c60 SHA512 c0cc9ebf4c8869be819065546b499b547990342c87425fae8f921a141704343f2a518ecfc2b8bfd527061902825fc5befcb2cd080c83ba887390e48338c9dc1a WHIRLPOOL 5a075579737d8a9ba5f62d6f90feb53a275bd31a8131d1b7d21395cf46cfefbdf4e48563b55734c995b9e3d8f9c37c78ea77f4e48920d64781190645ea36112b
diff --git a/sci-biology/clustalw/clustalw-1.83-r3.ebuild b/sci-biology/clustalw/clustalw-1.83-r3.ebuild
new file mode 100644
index 000000000000..6047a08ed466
--- /dev/null
+++ b/sci-biology/clustalw/clustalw-1.83-r3.ebuild
@@ -0,0 +1,36 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="General purpose multiple alignment program for DNA and proteins"
+HOMEPAGE="http://www.embl-heidelberg.de/~seqanal/"
+SRC_URI="ftp://ftp.ebi.ac.uk/pub/software/unix/clustalw/${PN}${PV}.UNIX.tar.gz"
+
+LICENSE="clustalw"
+SLOT="1"
+KEYWORDS="alpha amd64 ppc ppc64 sparc x86 ~amd64-linux ~x86-linux ~ppc-macos ~sparc-solaris"
+IUSE=""
+
+S="${WORKDIR}"/${PN}${PV}
+
+src_prepare() {
+ epatch "${FILESDIR}"/${PV}-as-needed.patch
+
+ sed \
+ -e "/^CC/s:cc:$(tc-getCC):g" \
+ -i makefile || die
+ sed \
+ -e "s%clustalw_help%/usr/share/doc/${PF}/clustalw_help%" \
+ -i clustalw.c || die
+}
+
+src_install() {
+ dobin clustalw
+ dodoc README clustalv.doc clustalw.doc clustalw.ms
+ insinto /usr/share/doc/${PF}
+ doins clustalw_help
+}
diff --git a/sci-biology/clustalw/clustalw-2.1.ebuild b/sci-biology/clustalw/clustalw-2.1.ebuild
new file mode 100644
index 000000000000..8664ee3108ec
--- /dev/null
+++ b/sci-biology/clustalw/clustalw-2.1.ebuild
@@ -0,0 +1,14 @@
+# Copyright 1999-2012 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=4
+
+DESCRIPTION="General purpose multiple alignment program for DNA and proteins"
+HOMEPAGE="http://www.clustal.org/"
+SRC_URI="http://www.clustal.org/download/current/${P}.tar.gz"
+
+LICENSE="GPL-3 LGPL-3"
+SLOT="2"
+KEYWORDS="amd64 x86 ~amd64-linux ~x86-linux ~ppc-macos ~sparc-solaris"
+IUSE=""
diff --git a/sci-biology/clustalw/files/1.83-as-needed.patch b/sci-biology/clustalw/files/1.83-as-needed.patch
new file mode 100644
index 000000000000..62b4654cddea
--- /dev/null
+++ b/sci-biology/clustalw/files/1.83-as-needed.patch
@@ -0,0 +1,17 @@
+--- makefile 2003-01-29 09:53:45.000000000 +0100
++++ makefile.new 2009-08-17 08:33:16.000000000 +0200
+@@ -11,11 +11,11 @@
+ HEADERS = general.h clustalw.h
+
+ CC = cc
+-CFLAGS = -c -O
+-LFLAGS = -O -lm
++CFLAGS += -c
++LIBS = -lm
+
+ clustalw : $(OBJECTS) amenu.o clustalw.o
+- $(CC) -o $@ $(OBJECTS) amenu.o clustalw.o $(LFLAGS)
++ $(CC) $(LDFLAGS) -o $@ $(OBJECTS) amenu.o clustalw.o $(LIBS)
+
+ interface.o : interface.c $(HEADERS) param.h
+ $(CC) $(CFLAGS) $*.c
diff --git a/sci-biology/clustalw/metadata.xml b/sci-biology/clustalw/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/clustalw/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/clustalx/Manifest b/sci-biology/clustalx/Manifest
new file mode 100644
index 000000000000..acbf2db29963
--- /dev/null
+++ b/sci-biology/clustalx/Manifest
@@ -0,0 +1 @@
+DIST clustalx-2.1.tar.gz 341649 SHA256 e10adb728c320598a165ca529f1aa3d2560061de0236e0a0926eaca9554afa05 SHA512 e8cbad783722161de6999ab01a91d555fc10db609197a8d2878f91e9d7dc998784c02d2ccb54c4936ee27b41321db6f4f37021221662f483b8b6d945b6e1c026 WHIRLPOOL 6cbe8dcf2be3a535e8ac0ef0b9b476d4429a80bd94b394c0194f46ed039f9ac2b97b0ec2ed680838a0973b3187b2dbc90285733657975e03288b9840ba3d6b15
diff --git a/sci-biology/clustalx/clustalx-2.1-r1.ebuild b/sci-biology/clustalx/clustalx-2.1-r1.ebuild
new file mode 100644
index 000000000000..9aa885eaa5bb
--- /dev/null
+++ b/sci-biology/clustalx/clustalx-2.1-r1.ebuild
@@ -0,0 +1,43 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils qt4-r2
+
+DESCRIPTION="Graphical interface for the ClustalW multiple alignment program"
+HOMEPAGE="http://www.ebi.ac.uk/tools/clustalw2/"
+SRC_URI="http://www.clustal.org/download/current/${P}.tar.gz"
+
+LICENSE="GPL-3 LGPL-3"
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE=""
+
+DEPEND="
+ dev-qt/qtcore:4
+ dev-qt/qtgui:4"
+RDEPEND="${DEPEND}
+ >=sci-biology/clustalw-${PV}"
+
+src_prepare() {
+ sed \
+ -e "s|colprot.xml|${EPREFIX}/usr/share/${PN}/colprot.xml|" \
+ -e "s|coldna.xml|${EPREFIX}/usr/share/${PN}/coldna.xml|" \
+ -e "s|colprint.xml|${EPREFIX}/usr/share/${PN}/colprint.xml|" \
+ -i ClustalQtParams.h || \
+ die "Failed to patch shared files location."
+ sed \
+ -e "s|clustalx.hlp|${EPREFIX}/usr/share/${PN}/clustalx.hlp|" \
+ -i HelpDisplayWidget.cpp || \
+ die "Failed to patch help file location."
+ rm -rf usr || die
+}
+
+src_install() {
+ dobin clustalx
+ insinto /usr/share/${PN}
+ doins colprot.xml coldna.xml colprint.xml clustalx.hlp
+ make_desktop_entry ${PN} ClustalX
+}
diff --git a/sci-biology/clustalx/metadata.xml b/sci-biology/clustalx/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/clustalx/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/consed/Manifest b/sci-biology/consed/Manifest
new file mode 100644
index 000000000000..e9cd6b128266
--- /dev/null
+++ b/sci-biology/consed/Manifest
@@ -0,0 +1,4 @@
+DIST consed-19-linux.tar.gz 29835559 SHA256 27501d714e4cd7ea04def6a7f985b674bc454ed8bd7d1e86b41b0283e2b9e089
+DIST consed-19-sources.tar.gz 6867357 SHA256 1db37b17608e49470926dae261c76d400cf3f9eb5feea52cd732e0bfa4cadee3
+DIST consed-27-linux.tar.gz 1604 SHA256 d7baafcbcdbf1b25262578511da8a51758f48d97d9109b334978acd150461855 SHA512 dbafb8c8f40dbed82a0000314549452c372e447467ccd8ec1004f44946dd09fcffa065c36bcca4f3c0fd55a137e570c135f4f79820e3e6d98626f92413b2731b WHIRLPOOL ae319734572558dd0047dad085c9f907386be6f7f0041bac0df9e1ce5b7558c750d92ea747cc3e74c594c83bed4cd73f4b37b4d6b9e39fd7caa2a733d67d6e21
+DIST consed-27-sources.tar.gz 1604 SHA256 d7baafcbcdbf1b25262578511da8a51758f48d97d9109b334978acd150461855 SHA512 dbafb8c8f40dbed82a0000314549452c372e447467ccd8ec1004f44946dd09fcffa065c36bcca4f3c0fd55a137e570c135f4f79820e3e6d98626f92413b2731b WHIRLPOOL ae319734572558dd0047dad085c9f907386be6f7f0041bac0df9e1ce5b7558c750d92ea747cc3e74c594c83bed4cd73f4b37b4d6b9e39fd7caa2a733d67d6e21
diff --git a/sci-biology/consed/consed-19-r2.ebuild b/sci-biology/consed/consed-19-r2.ebuild
new file mode 100644
index 000000000000..3ce704e8792f
--- /dev/null
+++ b/sci-biology/consed/consed-19-r2.ebuild
@@ -0,0 +1,71 @@
+# Copyright 1999-2013 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=3
+
+inherit toolchain-funcs
+
+DESCRIPTION="A genome sequence finishing program"
+HOMEPAGE="http://bozeman.mbt.washington.edu/consed/consed.html"
+SRC_URI="${P}-sources.tar.gz
+ ${P}-linux.tar.gz"
+
+LICENSE="phrap"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+DEPEND=">=x11-libs/motif-2.3:0"
+RDEPEND="${DEPEND}
+ >=sci-biology/phred-000925
+ >=sci-biology/phrap-1.080721"
+
+S="${WORKDIR}"
+
+RESTRICT="fetch"
+
+pkg_nofetch() {
+ einfo "Please visit ${HOMEPAGE} and obtain the file"
+ einfo "\"sources.tar.gz\", then rename it to \"${P}-sources.tar.gz\""
+ einfo "and place it in ${DISTDIR},"
+ einfo "obtain the file"
+ einfo "\"consed_linux.tar.gz\", then rename it to \"${P}-linux.tar.gz\""
+ einfo "and place it in ${DISTDIR}"
+}
+
+src_prepare() {
+ sed -i '/#include/ s/<new.h>/<new>/' "${S}/main.cpp" || die
+ sed -i \
+ -e '/CLIBS=/ s/$/ -lXm -lXt -lSM -lICE -lXext -lXmu -lXp -lm/' \
+ -e 's/ARCHIVES=/ARCHIVES=\n_ARCHIVES=/' \
+ -e 's/CFLGS=/CFLGS= ${CFLAGS} /' "${S}/makefile" || die
+ sed -i -e 's/CFLAGS=/CFLAGS += /' "${S}"/misc/*/Makefile || die
+ sed -i 's!\($szPhredParameterFile =\).*!\1 $ENV{PHRED_PARAMETER_FILE} || "'${EPREFIX}'/usr/share/phred/phredpar.dat";!' "${S}/scripts/"* || die
+}
+
+src_compile() {
+ emake || die
+ emake -C misc/mktrace || die
+ emake -C misc/phd2fasta || die
+ (cd misc/454; $(tc-getCC) ${CFLAGS} sff2scf.c -o sff2scf) || die
+}
+
+src_install() {
+ dobin consed misc/{mktrace/mktrace,phd2fasta/phd2fasta,454/sff2scf} || die
+ dobin scripts/* contributions/* || die
+ insinto /usr/lib/screenLibs
+ doins misc/*.{fa*,seq} || die
+ insinto /usr/share/${PN}/examples
+ doins -r standard polyphred autofinish assembly_view 454_newbler \
+ align454reads align454reads_answer solexa_example \
+ solexa_example_answer selectRegions selectRegionsAnswer || die
+ echo 'CONSED_HOME='${EPREFIX}'/usr' > "${S}/99consed"
+ doenvd "${S}/99consed" || die
+ dodoc README.txt *_announcement.txt || die
+}
+
+pkg_postinst() {
+ einfo "Package documentation is available at"
+ einfo "http://www.phrap.org/consed/distributions/README.${PV}.0.txt"
+}
diff --git a/sci-biology/consed/consed-27.ebuild b/sci-biology/consed/consed-27.ebuild
new file mode 100644
index 000000000000..0bf33a7278cf
--- /dev/null
+++ b/sci-biology/consed/consed-27.ebuild
@@ -0,0 +1,90 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="A genome sequence finishing program"
+HOMEPAGE="http://bozeman.mbt.washington.edu/consed/consed.html"
+SRC_URI="
+ ${P}-sources.tar.gz
+ ${P}-linux.tar.gz"
+
+LICENSE="phrap"
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+IUSE=""
+
+DEPEND=">=x11-libs/motif-2.3:0"
+RDEPEND="${DEPEND}
+ sci-biology/samtools
+ >=sci-biology/phred-000925
+ >=sci-biology/phrap-1.080721
+ dev-lang/perl"
+
+S="${WORKDIR}"
+
+RESTRICT="fetch"
+
+pkg_nofetch() {
+ einfo "Please visit ${HOMEPAGE} and obtain the file"
+ einfo "\"sources.tar.gz\", then rename it to \"${P}-sources.tar.gz\""
+ einfo "and place it in ${DISTDIR},"
+ einfo "obtain the file"
+ einfo "\"consed_linux.tar.gz\", then rename it to \"${P}-linux.tar.gz\""
+ einfo "and place it in ${DISTDIR}"
+}
+
+src_prepare() {
+ sed -i '/#include/ s/<new.h>/<new>/' "${S}/main.cpp" || die
+ sed -i \
+ -e '/CLIBS=/ s/$/ -lXm -lXt -lSM -lICE -lXext -lXmu -lXp -lm -lbam -lz/' \
+ -e 's/ARCHIVES=/ARCHIVES=\n_ARCHIVES=/' \
+ -e 's/CFLGS=/CFLGS= ${CFLAGS} /' \
+ -e 's#/me1/gordon/samtools/samtools-0.1.18#/usr/include/bam/#' "${S}/makefile" || die
+ sed -i -e 's/CFLAGS=/CFLAGS += /' "${S}"/misc/*/Makefile || die
+ sed \
+ -e 's!\($szPhredParameterFile =\).*!\1 $ENV{PHRED_PARAMETER_FILE} || "'${EPREFIX}'/usr/share/phred/phredpar.dat";!' \
+ -i "${S}"/scripts/* || die
+}
+
+src_compile() {
+ emake
+ emake -C misc/mktrace
+ emake -C misc/phd2fasta
+ (cd misc/454; $(tc-getCC) ${CFLAGS} ${LDFLAGS} sff2scf.c -o sff2scf) || die
+}
+
+src_install() {
+ dobin consed misc/{mktrace/mktrace,phd2fasta/phd2fasta,454/sff2scf}
+ dobin scripts/* contributions/*
+ insinto /usr/lib/screenLibs
+ doins misc/*.{fa*,seq}
+ insinto /usr/share/${PN}/examples
+ doins -r \
+ standard polyphred autofinish assembly_view 454_newbler \
+ align454reads align454reads_answer solexa_example \
+ solexa_example_answer selectRegions selectRegionsAnswer
+ echo 'CONSED_HOME="${EPREFIX}/usr"' > "${S}"/99consed || die
+ echo 'CONSED_PARAMETERS="${EPREFIX}/etc/consedrc"' >> "${S}"/99consed || die
+ mkdir -p "${ED}"/etc/consedrc || die
+ touch "${ED}"/etc/consedrc || die
+ doenvd "${S}/99consed" || die
+ sed \
+ -e "s#/usr/local/genome#${EPREFIX}/usr#" \
+ -i "${ED}"/usr/bin/{*.perl,phredPhrap,phredPhrapWithPhdBalls} || die
+ sed \
+ -e 's#niceExe = "/bin/nice"#niceExe = "/usr/bin/nice"#' \
+ -i "${ED}"/usr/bin/phredPhrap || die
+ sed \
+ -e 's#/wt1/gordon/genome#/usr/bin#' \
+ -i "${ED}"/usr/bin/fastq2Phrap.perl || die
+ dodoc README.txt *_announcement.txt || die
+}
+
+pkg_postinst() {
+ einfo "Package documentation is available at"
+ einfo "http://www.phrap.org/consed/distributions/README.${PV}.0.txt"
+}
diff --git a/sci-biology/consed/metadata.xml b/sci-biology/consed/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/consed/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/cufflinks/Manifest b/sci-biology/cufflinks/Manifest
new file mode 100644
index 000000000000..017836ee07ad
--- /dev/null
+++ b/sci-biology/cufflinks/Manifest
@@ -0,0 +1,2 @@
+DIST cufflinks-1.3.0.tar.gz 676660 SHA256 c1e194e30e6ba2e1cbbd35e5f92be59f9fdef95a12079b3141790efbbdbdfd86 SHA512 b493c06b00093958aa3bf4aefa6435b89aa3fa8f90b9adea955b38aaa0301fafe3f028321573855d2af9515f9792a8a9c3851bd9352846131658e54b5a6ac68a WHIRLPOOL 649ed7638bdc655cc38d9c0ec6c81bc464e648e6e684e31af955a424510ee4702e2cec8e3dbfa2d97859ed27e04ff45fe2e07cb0a548c87674337bb94f5352ce
+DIST cufflinks-2.2.1.tar.gz 766280 SHA256 e8316b66177914f14b3a0c317e436d386a46c4c212ca1b2326f89f8a2e08d5ae SHA512 4da7f3a6090ea8cf469a85208c91073abdcd8b0e71c51b0f7052ce8001c368055b9d9cb7726d463196f5b3ab0b4a49bf5241d321ac3fe061225ecc47b4ca209b WHIRLPOOL bd40e6612f3c16466cf14efe706e38663c61d01661f901d9fdb140d0419e47e2ff10515dc7a0ff81da081e87af6d5d393d88cc4d036e8b921491fb5a790ae224
diff --git a/sci-biology/cufflinks/cufflinks-1.3.0-r1.ebuild b/sci-biology/cufflinks/cufflinks-1.3.0-r1.ebuild
new file mode 100644
index 000000000000..36322f463de6
--- /dev/null
+++ b/sci-biology/cufflinks/cufflinks-1.3.0-r1.ebuild
@@ -0,0 +1,40 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=yes
+
+inherit autotools-utils
+
+DESCRIPTION="Transcript assembly, differential expression, and differential regulation for RNA-Seq"
+HOMEPAGE="http://cufflinks.cbcb.umd.edu/"
+SRC_URI="http://cufflinks.cbcb.umd.edu/downloads/${P}.tar.gz"
+
+SLOT="0"
+LICENSE="Artistic"
+IUSE="debug"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ >=sci-biology/samtools-0.1.18
+ <sci-biology/samtools-1
+ <dev-libs/boost-1.56:="
+RDEPEND="${DEPEND}"
+
+PATCHES=(
+ "${FILESDIR}"/${P}-autotools.patch
+ "${FILESDIR}"/${P}-boost.patch
+ "${FILESDIR}"/${P}-gcc-4.7.patch
+ )
+
+src_configure() {
+ local myeconfargs=(
+ --disable-optim
+ --with-boost-libdir="${EPREFIX}/usr/$(get_libdir)/"
+ --with-bam="${EPREFIX}/usr/"
+ $(use_enable debug)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/cufflinks/cufflinks-2.2.1-r1.ebuild b/sci-biology/cufflinks/cufflinks-2.2.1-r1.ebuild
new file mode 100644
index 000000000000..66298cbc1972
--- /dev/null
+++ b/sci-biology/cufflinks/cufflinks-2.2.1-r1.ebuild
@@ -0,0 +1,52 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=true
+
+inherit autotools-utils flag-o-matic toolchain-funcs
+
+DESCRIPTION="Transcript assembly, differential expression, and differential regulation for RNA-Seq"
+HOMEPAGE="http://cufflinks.cbcb.umd.edu/"
+SRC_URI="http://cufflinks.cbcb.umd.edu/downloads/${P}.tar.gz"
+
+SLOT="0"
+LICENSE="Artistic"
+IUSE="debug"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ || (
+ (
+ >=sci-biology/samtools-0.1.18
+ sci-libs/htslib
+ )
+ <sci-biology/samtools-1
+ )
+ >=dev-libs/boost-1.47.0:=
+ <dev-libs/boost-1.56.0:=
+ dev-cpp/eigen:3
+"
+RDEPEND="${DEPEND}"
+
+PATCHES=(
+ "${FILESDIR}"/${P}-hts.patch
+ "${FILESDIR}"/${P}-flags.patch
+ )
+
+src_prepare() {
+ append-cppflags $($(tc-getPKG_CONFIG) --cflags eigen3)
+ autotools-utils_src_prepare
+}
+
+src_configure() {
+ local myeconfargs=(
+ --disable-optim
+ --with-boost-libdir="${EPREFIX}/usr/$(get_libdir)/"
+ --with-bam="${EPREFIX}/usr/"
+ $(use_enable debug)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/cufflinks/cufflinks-2.2.1.ebuild b/sci-biology/cufflinks/cufflinks-2.2.1.ebuild
new file mode 100644
index 000000000000..5e7f763389f9
--- /dev/null
+++ b/sci-biology/cufflinks/cufflinks-2.2.1.ebuild
@@ -0,0 +1,40 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit autotools-utils flag-o-matic toolchain-funcs
+
+DESCRIPTION="Transcript assembly, differential expression, and differential regulation for RNA-Seq"
+HOMEPAGE="http://cufflinks.cbcb.umd.edu/"
+SRC_URI="http://cufflinks.cbcb.umd.edu/downloads/${P}.tar.gz"
+
+SLOT="0"
+LICENSE="Artistic"
+IUSE="debug"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="
+ >=sci-biology/samtools-0.1.18
+ <sci-biology/samtools-1
+ >=dev-libs/boost-1.47.0:=
+ <dev-libs/boost-1.56.0:=
+ dev-cpp/eigen:3
+"
+RDEPEND="${DEPEND}"
+
+src_prepare() {
+ append-cppflags $($(tc-getPKG_CONFIG) --cflags eigen3)
+ autotools-utils_src_prepare
+}
+
+src_configure() {
+ local myeconfargs=(
+ --disable-optim
+ --with-boost-libdir="${EPREFIX}/usr/$(get_libdir)/"
+ --with-bam="${EPREFIX}/usr/"
+ $(use_enable debug)
+ )
+ autotools-utils_src_configure
+}
diff --git a/sci-biology/cufflinks/files/cufflinks-1.3.0-autotools.patch b/sci-biology/cufflinks/files/cufflinks-1.3.0-autotools.patch
new file mode 100644
index 000000000000..73e52b4343a0
--- /dev/null
+++ b/sci-biology/cufflinks/files/cufflinks-1.3.0-autotools.patch
@@ -0,0 +1,38 @@
+--- a/configure.ac
++++ b/configure.ac
+@@ -27,6 +27,7 @@ AC_PROG_AWK
+ AC_PROG_CXX
+ AC_PROG_CC
+ AC_PROG_MAKE_SET
++AM_PROG_AR
+ AC_PROG_RANLIB
+ AC_PROG_INSTALL
+ AM_PATH_PYTHON([2.4])
+@@ -54,7 +55,7 @@ AC_CANONICAL_HOST
+
+ # set CFLAGS and CXXFLAGS
+ user_CFLAGS=${CFLAGS}
+-generic_CFLAGS="-Wall -Wno-strict-aliasing -g -gdwarf-2 -Wuninitialized"
++generic_CFLAGS="-Wall -Wno-strict-aliasing -Wuninitialized"
+ ext_CFLAGS=""
+ debug_CFLAGS=""
+ #echo "${host_cpu}-${host_os}"
+@@ -99,15 +100,15 @@ AC_ARG_ENABLE(profiling, [ --enable-profiling enable profiling with
+ [ext_LDFLAGS="-lprofiler -ltcmalloc"], [])
+
+ CFLAGS="${generic_CFLAGS} ${ext_CFLAGS} ${user_CFLAGS} ${debug_CFLAGS} ${OPENMP_CFLAGS}"
+-CXXFLAGS="$CFLAGS"
++CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $BOOST_CPPFLAGS $BAM_CPPFLAGS"
+-LDFLAGS="$ext_LDFLAGS"
++LDFLAGS="$LDFLAGS $ext_LDFLAGS"
+
+ # Checks for structures/functions that can be used to determine system memory
+ AC_CHECK_MEMBERS([struct sysinfo.totalram], [], [], [#include <sys/sysinfo.h>])
+ AC_CHECK_DECLS([sysctl, CTL_HW, HW_PHYSMEM], [], [], [#include <sys/sysctl.h>])
+
+-AM_INIT_AUTOMAKE([-Wall -Werror tar-pax foreign])
++AM_INIT_AUTOMAKE([-Wall tar-pax foreign subdir-objects])
+
+ AC_CONFIG_FILES([Makefile
+ src/Makefile])
diff --git a/sci-biology/cufflinks/files/cufflinks-1.3.0-boost.patch b/sci-biology/cufflinks/files/cufflinks-1.3.0-boost.patch
new file mode 100644
index 000000000000..d45391bf4f3a
--- /dev/null
+++ b/sci-biology/cufflinks/files/cufflinks-1.3.0-boost.patch
@@ -0,0 +1,1320 @@
+ ax_boost_thread.m4 | 6 +++---
+ src/abundances.cpp | 56 +++++++++++++++++++++++++-------------------------
+ src/biascorrection.cpp | 2 +-
+ src/bundles.cpp | 10 ++++-----
+ src/bundles.h | 10 ++++-----
+ src/common.h | 4 ++--
+ src/compress_gtf.cpp | 12 +++++------
+ src/cuffdiff.cpp | 30 +++++++++++++--------------
+ src/cufflinks.cpp | 34 +++++++++++++++---------------
+ src/differential.cpp | 38 +++++++++++++++++-----------------
+ src/filters.cpp | 8 ++++----
+ src/genes.h | 6 +++---
+ src/gtf_to_sam.cpp | 8 ++++----
+ src/hits.cpp | 4 ++--
+ src/replicates.cpp | 6 +++---
+ src/replicates.h | 18 ++++++++--------
+ src/scaffolds.cpp | 28 ++++++++++++-------------
+ src/scaffolds.h | 2 +-
+ 18 files changed, 141 insertions(+), 141 deletions(-)
+
+diff --git a/ax_boost_thread.m4 b/ax_boost_thread.m4
+index d1d42f6..6f99f1b 100644
+--- a/ax_boost_thread.m4
++++ b/ax_boost_thread.m4
+@@ -105,20 +105,20 @@ AC_DEFUN([AX_BOOST_THREAD],
+ for libextension in `ls $BOOSTLIBDIR/libboost_thread*.so* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^lib\(boost_thread.*\)\.so.*$;\1;'` `ls $BOOSTLIBDIR/libboost_thread*.a* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^lib\(boost_thread.*\)\.a*$;\1;'`; do
+ ax_lib=${libextension}
+ AC_CHECK_LIB($ax_lib, exit,
+- [BOOST_THREAD_LIB="-l$ax_lib"; AC_SUBST(BOOST_THREAD_LIB) link_thread="yes"; break],
++ [BOOST_THREAD_LIB="-l$ax_lib -lboost_system"; AC_SUBST(BOOST_THREAD_LIB) link_thread="yes"; break],
+ [link_thread="no"])
+ done
+ if test "x$link_thread" != "xyes"; then
+ for libextension in `ls $BOOSTLIBDIR/boost_thread*.dll* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^\(boost_thread.*\)\.dll.*$;\1;'` `ls $BOOSTLIBDIR/boost_thread*.a* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^\(boost_thread.*\)\.a*$;\1;'` ; do
+ ax_lib=${libextension}
+ AC_CHECK_LIB($ax_lib, exit,
+- [BOOST_THREAD_LIB="-l$ax_lib"; AC_SUBST(BOOST_THREAD_LIB) link_thread="yes"; break],
++ [BOOST_THREAD_LIB="-l$ax_lib -lboost_system"; AC_SUBST(BOOST_THREAD_LIB) link_thread="yes"; break],
+ [link_thread="no"])
+ done
+ fi
+
+ else
+- BOOST_THREAD_LIB="$ax_boost_user_thread_lib";
++ BOOST_THREAD_LIB="$ax_boost_user_thread_lib -lboost_system";
+ AC_SUBST(BOOST_THREAD_LIB)
+ link_thread="yes";
+
+diff --git a/src/abundances.cpp b/src/abundances.cpp
+index d8f81d0..6e717dc 100644
+--- a/src/abundances.cpp
++++ b/src/abundances.cpp
+@@ -140,7 +140,7 @@ AbundanceStatus AbundanceGroup::status() const
+ {
+ bool has_lowdata_member = false;
+ bool has_ok_member = false;
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ if (ab->status() == NUMERIC_FAIL)
+ {
+@@ -205,7 +205,7 @@ void TranscriptAbundance::FPKM_variance(double v)
+
+ bool AbundanceGroup::has_member_with_status(AbundanceStatus member_status)
+ {
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ if (ab->status() == member_status)
+ {
+@@ -219,7 +219,7 @@ double AbundanceGroup::num_fragments() const
+ {
+ double num_f = 0;
+
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ num_f += ab->num_fragments();
+ }
+@@ -231,7 +231,7 @@ double AbundanceGroup::mass_fraction() const
+ {
+ double mass = 0;
+
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ mass += ab->mass_fraction();
+ }
+@@ -242,7 +242,7 @@ double AbundanceGroup::mass_variance() const
+ {
+ double mass_var = 0;
+
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ mass_var += ab->mass_variance();
+ }
+@@ -253,7 +253,7 @@ double AbundanceGroup::FPKM() const
+ {
+ double fpkm = 0;
+
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ fpkm += ab->FPKM();
+ }
+@@ -265,7 +265,7 @@ double AbundanceGroup::gamma() const
+ {
+ double gamma = 0;
+
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ gamma += ab->gamma();
+ }
+@@ -281,7 +281,7 @@ void AbundanceGroup::filter_group(const vector<bool>& to_keep,
+ assert (to_keep.size() == _abundances.size());
+
+ size_t num_kept = 0;
+- foreach(bool keeper, to_keep)
++ for_each(bool keeper, to_keep)
+ {
+ num_kept += keeper;
+ }
+@@ -331,7 +331,7 @@ void AbundanceGroup::filter_group(const vector<bool>& to_keep,
+ void AbundanceGroup::get_transfrags(vector<shared_ptr<Abundance> >& transfrags) const
+ {
+ transfrags.clear();
+- foreach(shared_ptr<Abundance> pA, _abundances)
++ for_each(shared_ptr<Abundance> pA, _abundances)
+ {
+ shared_ptr<Scaffold> pS = pA->transfrag();
+ if (pS)
+@@ -345,7 +345,7 @@ set<string> AbundanceGroup::gene_id() const
+ {
+ set<string> s;
+
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ set<string> sub = pA->gene_id();
+ s.insert(sub.begin(), sub.end());
+@@ -358,7 +358,7 @@ set<string> AbundanceGroup::gene_name() const
+ {
+ set<string> s;
+
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ set<string> sub = pA->gene_name();
+ s.insert(sub.begin(), sub.end());
+@@ -372,7 +372,7 @@ set<string> AbundanceGroup::tss_id() const
+ {
+ set<string> s;
+
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ set<string> sub = pA->tss_id();
+ s.insert(sub.begin(), sub.end());
+@@ -385,7 +385,7 @@ set<string> AbundanceGroup::protein_id() const
+ {
+ set<string> s;
+
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ set<string> sub = pA->protein_id();
+ s.insert(sub.begin(), sub.end());
+@@ -398,7 +398,7 @@ const string& AbundanceGroup::locus_tag() const
+ {
+ static string default_locus_tag = "-";
+ const string* pLast = NULL;
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ if (pLast)
+ {
+@@ -422,7 +422,7 @@ const string& AbundanceGroup::reference_tag() const
+ {
+ static string default_reference_tag = "-";
+ const string* pLast = NULL;
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ if (pLast)
+ {
+@@ -448,7 +448,7 @@ double AbundanceGroup::effective_length() const
+ double group_fpkm = FPKM();
+ if (group_fpkm == 0)
+ return 0;
+- foreach (shared_ptr<Abundance> ab, _abundances)
++ for_each (shared_ptr<Abundance> ab, _abundances)
+ {
+ eff_len += (ab->effective_length() * (ab->FPKM() / group_fpkm));
+ }
+@@ -1216,7 +1216,7 @@ void AbundanceGroup::estimate_count_covariance()
+ {
+ // if the entire group is unstable, then set LOWDATA on all members of
+ // it to reduce false positives in differential expression analysis.
+- foreach(shared_ptr<Abundance> ab, _abundances)
++ for_each(shared_ptr<Abundance> ab, _abundances)
+ {
+ ab->status(NUMERIC_LOW_DATA);
+ }
+@@ -1468,7 +1468,7 @@ void AbundanceGroup::calculate_conf_intervals()
+ double sum_transfrag_FPKM_hi = 0;
+ double max_fpkm = 0.0;
+ //double min_fpkm = 1e100;
+- foreach(shared_ptr<Abundance> pA, _abundances)
++ for_each(shared_ptr<Abundance> pA, _abundances)
+ {
+ double FPKM_hi;
+ double FPKM_lo;
+@@ -1586,7 +1586,7 @@ void AbundanceGroup::calculate_conf_intervals()
+ // double sum_transfrag_FPKM_hi = 0;
+ // double max_fpkm = 0.0;
+ // //double min_fpkm = 1e100;
+-// foreach(shared_ptr<Abundance> pA, _abundances)
++// for_each(shared_ptr<Abundance> pA, _abundances)
+ // {
+ // double FPKM_hi;
+ // double FPKM_lo;
+@@ -1732,7 +1732,7 @@ bool AbundanceGroup::calculate_gammas(const vector<MateHit>& nr_alignments,
+ if (mapped_transcripts.empty())
+ {
+ //gammas = vector<double>(transfrags.size(), 0.0);
+- foreach (shared_ptr<Abundance> ab, _abundances)
++ for_each (shared_ptr<Abundance> ab, _abundances)
+ {
+ ab->gamma(0);
+ }
+@@ -1783,7 +1783,7 @@ bool AbundanceGroup::calculate_gammas(const vector<MateHit>& nr_alignments,
+ if (filtered_transcripts.empty())
+ {
+ //gammas = vector<double>(transfrags.size(), 0.0);
+- foreach (shared_ptr<Abundance> ab, _abundances)
++ for_each (shared_ptr<Abundance> ab, _abundances)
+ {
+ ab->gamma(0);
+ }
+@@ -2117,7 +2117,7 @@ void AbundanceGroup::calculate_kappas()
+ double S_FPKM = 0.0;
+ double Z_kappa = 0.0;
+ double X_S = 0.0;
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ if (pA->effective_length() > 0)
+ {
+@@ -2128,7 +2128,7 @@ void AbundanceGroup::calculate_kappas()
+ }
+
+ //fprintf (stderr, "*********\n");
+- foreach (shared_ptr<Abundance> pA, _abundances)
++ for_each (shared_ptr<Abundance> pA, _abundances)
+ {
+ if (S_FPKM > 0)
+ {
+@@ -2201,7 +2201,7 @@ void get_alignments_from_scaffolds(const vector<shared_ptr<Abundance> >& abundan
+ {
+ set<const MateHit*> hits_in_gene_set;
+
+- foreach(shared_ptr<Abundance> pA, abundances)
++ for_each(shared_ptr<Abundance> pA, abundances)
+ {
+ shared_ptr<Scaffold> pS = pA->transfrag();
+ assert (pS);
+@@ -2787,7 +2787,7 @@ AbundanceStatus empirical_mean_replicate_gamma_mle(const vector<shared_ptr<Abund
+ gamma_covariance = ublas::zero_matrix<double>(N,N);
+ ublas::vector<double> expected_mle_gamma = ublas::zero_vector<double>(N);
+ //
+- foreach(ublas::vector<double>& mle, mle_gammas)
++ for_each(ublas::vector<double>& mle, mle_gammas)
+ {
+ expected_mle_gamma += mle;
+ }
+@@ -3122,7 +3122,7 @@ AbundanceStatus bootstrap_gamma_mle(const vector<shared_ptr<Abundance> >& transc
+ gamma_covariance = ublas::zero_matrix<double>(N,N);
+ ublas::vector<double> expected_mle_gamma = ublas::zero_vector<double>(N);
+
+- foreach(ublas::vector<double>& mle, mle_gammas)
++ for_each(ublas::vector<double>& mle, mle_gammas)
+ {
+ //cerr << "MLE # "<< MLENUM++ << endl;
+ //cerr << mle << endl;
+@@ -3586,7 +3586,7 @@ AbundanceStatus gamma_mle(const vector<shared_ptr<Abundance> >& transcripts,
+
+ double round_err = 0.0;
+ double num_good = 0;
+- foreach (double& g, gammas)
++ for_each (double& g, gammas)
+ {
+ if (g < min_isoform_fraction)
+ {
+@@ -3598,7 +3598,7 @@ AbundanceStatus gamma_mle(const vector<shared_ptr<Abundance> >& transcripts,
+ num_good += 1;
+ }
+ }
+- foreach (double& g, gammas)
++ for_each (double& g, gammas)
+ {
+ if (g != 0)
+ {
+diff --git a/src/biascorrection.cpp b/src/biascorrection.cpp
+index 0d49851..55884f4 100644
+--- a/src/biascorrection.cpp
++++ b/src/biascorrection.cpp
+@@ -207,7 +207,7 @@ void BiasLearner::preProcessTranscript(const Scaffold& transcript)
+ vector<double> startHist(transcript.length()+1, 0.0); // +1 catches overhangs
+ vector<double> endHist(transcript.length()+1, 0.0);
+
+- foreach (const MateHit* hit_p, transcript.mate_hits())
++ for_each (const MateHit* hit_p, transcript.mate_hits())
+ {
+ const MateHit& hit = *hit_p;
+ if (!hit.left_alignment() && !hit.right_alignment())
+diff --git a/src/bundles.cpp b/src/bundles.cpp
+index ead07f2..a392514 100644
+--- a/src/bundles.cpp
++++ b/src/bundles.cpp
+@@ -228,7 +228,7 @@ void load_ref_rnas(FILE* ref_mRNA_file,
+ }
+ }
+
+- foreach (shared_ptr<Scaffold> s, ref_mRNAs)
++ for_each (shared_ptr<Scaffold> s, ref_mRNAs)
+ {
+ assert (s);
+ }
+@@ -418,7 +418,7 @@ void HitBundle::finalize_open_mates()
+
+ for(OpenMates::iterator itr = _open_mates.begin(); itr != _open_mates.end(); ++itr)
+ {
+- foreach (MateHit& hit, itr->second)
++ for_each (MateHit& hit, itr->second)
+ {
+ delete hit.left_alignment();
+ delete hit.right_alignment();
+@@ -438,7 +438,7 @@ void HitBundle::remove_hitless_scaffolds()
+ void HitBundle::remove_unmapped_hits()
+ {
+
+- foreach (MateHit& hit, _hits)
++ for_each (MateHit& hit, _hits)
+ {
+ if (unmapped_hit(hit))
+ {
+@@ -586,7 +586,7 @@ void HitBundle::finalize(bool is_combined)
+ }
+ else
+ {
+- foreach (MateHit& hit, _hits)
++ for_each (MateHit& hit, _hits)
+ {
+ hit.incr_collapse_mass(hit.common_scale_mass());
+ }
+@@ -1316,7 +1316,7 @@ void identify_bad_splices(const HitBundle& bundle,
+ ins_itr = bad_splice_ops.insert(make_pair(ref_id, vector<AugmentedCuffOp>()));
+ vector<AugmentedCuffOp>& bad_introns = ins_itr.first->second;
+
+- foreach (const MateHit& hit, bundle.hits())
++ for_each (const MateHit& hit, bundle.hits())
+ {
+ if (hit.left_alignment())
+ {
+diff --git a/src/bundles.h b/src/bundles.h
+index 15f51ee..aec725e 100644
+--- a/src/bundles.h
++++ b/src/bundles.h
+@@ -57,7 +57,7 @@ public:
+ ~HitBundle()
+ {
+ vector<shared_ptr<Scaffold> >& bundle_ref_scaffs = ref_scaffolds();
+- foreach(shared_ptr<Scaffold>& ref_scaff, bundle_ref_scaffs)
++ for_each(shared_ptr<Scaffold>& ref_scaff, bundle_ref_scaffs)
+ {
+ // This bundle and the factory that actually owns the ref_mRNAs
+ // are the only objects that should have access to these scaffolds
+@@ -73,7 +73,7 @@ public:
+ }
+ }
+
+- foreach (MateHit& hit, _hits)
++ for_each (MateHit& hit, _hits)
+ {
+ delete hit.left_alignment();
+ delete hit.right_alignment();
+@@ -81,7 +81,7 @@ public:
+
+ for(OpenMates::iterator itr = _open_mates.begin(); itr != _open_mates.end(); ++itr)
+ {
+- foreach (MateHit& hit, itr->second)
++ for_each (MateHit& hit, itr->second)
+ {
+ delete hit.left_alignment();
+ delete hit.right_alignment();
+@@ -113,7 +113,7 @@ public:
+ _hits.clear();
+ _non_redundant.clear();
+ vector<shared_ptr<Scaffold> >& bundle_ref_scaffs = ref_scaffolds();
+- foreach(shared_ptr<Scaffold>& ref_scaff, bundle_ref_scaffs)
++ for_each(shared_ptr<Scaffold>& ref_scaff, bundle_ref_scaffs)
+ {
+ if (ref_scaff.use_count() <= 3)
+ {
+@@ -250,7 +250,7 @@ public:
+ next_ref_scaff = ref_mRNAs.begin();
+ next_mask_scaff = mask_gtf_recs.begin();
+
+- foreach(shared_ptr<Scaffold> ref_scaff, ref_mRNAs)
++ for_each(shared_ptr<Scaffold> ref_scaff, ref_mRNAs)
+ {
+ ref_scaff->clear_hits();
+ }
+diff --git a/src/common.h b/src/common.h
+index b715e9c..1ed7d77 100644
+--- a/src/common.h
++++ b/src/common.h
+@@ -22,8 +22,8 @@
+ using boost::math::normal;
+
+ #include <boost/foreach.hpp>
+-#define foreach BOOST_FOREACH
+-#define reverse_foreach BOOST_REVERSE_FOREACH
++#define for_each BOOST_FOREACH
++#define reverse_for_each BOOST_REVERSE_FOREACH
+
+ #include <boost/thread.hpp>
+ #include <boost/shared_ptr.hpp>
+diff --git a/src/compress_gtf.cpp b/src/compress_gtf.cpp
+index a2cd10a..a3796fd 100644
+--- a/src/compress_gtf.cpp
++++ b/src/compress_gtf.cpp
+@@ -159,7 +159,7 @@ void compress_genes(FILE* ftranscripts,
+ vector<shared_ptr<Scaffold> >& gene = grouped_scaffolds[i];
+ vector<Scaffold> gene_scaffs;
+ string gene_id;
+- foreach (shared_ptr<Scaffold> s, gene)
++ for_each (shared_ptr<Scaffold> s, gene)
+ {
+ if (gene_id == "")
+ gene_id = s->annotated_gene_id();
+@@ -175,7 +175,7 @@ void compress_genes(FILE* ftranscripts,
+ Scaffold smashed_gene;
+ if (!proj_intersection && !proj_union)
+ {
+- foreach (shared_ptr<Scaffold> s, gene)
++ for_each (shared_ptr<Scaffold> s, gene)
+ {
+ /*
+ *transfrag,
+@@ -224,7 +224,7 @@ void compress_genes(FILE* ftranscripts,
+ int gmax = -1;
+ int gmin = numeric_limits<int>::max();
+
+- foreach (shared_ptr<Scaffold> s, gene)
++ for_each (shared_ptr<Scaffold> s, gene)
+ {
+ //iso_ops.push_back(s->augmented_ops());
+ //sort (iso_ops.back().begin(), iso_ops.back().end());
+@@ -234,7 +234,7 @@ void compress_genes(FILE* ftranscripts,
+ gmax = s->right();
+ }
+
+- foreach (shared_ptr<Scaffold> s, gene)
++ for_each (shared_ptr<Scaffold> s, gene)
+ {
+ if (s->left() > gmin)
+ {
+@@ -347,7 +347,7 @@ void driver(vector<FILE*> ref_gtf_files, FILE* gtf_out)
+ vector<vector<shared_ptr<Scaffold> > > ref_mRNA_table;
+ vector<pair<string, vector<double> > > sample_count_table;
+
+- foreach (FILE* ref_gtf, ref_gtf_files)
++ for_each (FILE* ref_gtf, ref_gtf_files)
+ {
+ vector<shared_ptr<Scaffold> > ref_mRNAs;
+ ::load_ref_rnas(ref_gtf, rt, ref_mRNAs, false, true);
+@@ -393,7 +393,7 @@ int main(int argc, char** argv)
+
+ vector<FILE*> ref_gtf_files;
+
+- foreach (const string& ref_gtf_in_filename, ref_gtf_filenames)
++ for_each (const string& ref_gtf_in_filename, ref_gtf_filenames)
+ {
+ FILE* ref_gtf = NULL;
+ if (ref_gtf_in_filename != "")
+diff --git a/src/cuffdiff.cpp b/src/cuffdiff.cpp
+index 575b064..7725910 100644
+--- a/src/cuffdiff.cpp
++++ b/src/cuffdiff.cpp
+@@ -490,7 +490,7 @@ void print_FPKM_tracking(FILE* fout,
+ const vector<FPKMContext>& fpkms = track.fpkm_series;
+
+ AbundanceStatus status = NUMERIC_OK;
+- foreach (const FPKMContext& c, fpkms)
++ for_each (const FPKMContext& c, fpkms)
+ {
+ if (c.status == NUMERIC_FAIL)
+ status = NUMERIC_FAIL;
+@@ -811,7 +811,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ ::load_ref_rnas(mask_gtf, rt, mask_rnas, false, false);
+ }
+
+- foreach (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
+ {
+ fac->set_ref_rnas(ref_mRNAs);
+ if (mask_gtf)
+@@ -826,7 +826,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ int tmp_max_frag_len = 0;
+
+ ProgressBar p_bar("Inspecting maps and determining fragment length distributions.",0);
+- foreach (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
+ {
+ #if ENABLE_THREADS
+ while(1)
+@@ -877,7 +877,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ {
+ long double total_mass = 0.0;
+ long double total_norm_mass = 0.0;
+- foreach (shared_ptr<ReadGroupProperties> rg, all_read_groups)
++ for_each (shared_ptr<ReadGroupProperties> rg, all_read_groups)
+ {
+ total_mass += rg->total_map_mass();
+ total_norm_mass += rg->normalized_map_mass();
+@@ -886,7 +886,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ if (total_mass > 0)
+ {
+ double scaling_factor = total_mass / total_norm_mass;
+- foreach (shared_ptr<ReadGroupProperties> rg, all_read_groups)
++ for_each (shared_ptr<ReadGroupProperties> rg, all_read_groups)
+ {
+ double scaled_mass = scaling_factor * rg->normalized_map_mass();
+
+@@ -916,7 +916,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+
+ if (most_reps != 1 && poisson_dispersion == false)
+ {
+- foreach (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> fac, bundle_factories)
+ {
+ if (fac->num_replicates() == 1)
+ {
+@@ -990,7 +990,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ shared_ptr<MassDispersionModel const> disperser;
+ disperser = fit_dispersion_model("pooled", scale_factors, sample_count_table);
+
+- foreach (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
++ for_each (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
+ {
+ rg_props->mass_dispersion_model(disperser);
+ }
+@@ -999,7 +999,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+
+ long double total_norm_mass = 0.0;
+ long double total_mass = 0.0;
+- foreach (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
++ for_each (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
+ {
+ total_norm_mass += rg_props->normalized_map_mass();
+ total_mass += rg_props->total_map_mass();
+@@ -1007,7 +1007,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+
+ // scale the normalized masses so that both quantile total count normalization
+ // are roughly on the same numerical scale
+- foreach (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
++ for_each (shared_ptr<ReadGroupProperties> rg_props, all_read_groups)
+ {
+ long double new_norm = rg_props->normalized_map_mass() * (total_mass / total_norm_mass);
+ rg_props->normalized_map_mass(new_norm);
+@@ -1039,7 +1039,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ shared_ptr<vector<shared_ptr<SampleAbundances> > > abundances(new vector<shared_ptr<SampleAbundances> >());
+ quantitate_next_locus(rt, bundle_factories, test_launcher);
+ bool more_loci_remain = false;
+- foreach (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
+ {
+ if (rep_fac->bundles_remain())
+ {
+@@ -1071,7 +1071,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ }
+ }
+
+- foreach (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
+ {
+ rep_fac->reset();
+ }
+@@ -1081,9 +1081,9 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ if (corr_bias)
+ {
+ p_bar = ProgressBar("Learning bias parameters.", 0);
+- foreach (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
+ {
+- foreach (shared_ptr<BundleFactory> fac, rep_fac->factories())
++ for_each (shared_ptr<BundleFactory> fac, rep_fac->factories())
+ {
+ #if ENABLE_THREADS
+ while(1)
+@@ -1124,7 +1124,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ boost::this_thread::sleep(boost::posix_time::milliseconds(5));
+ }
+ #endif
+- foreach (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
+ {
+ rep_fac->reset();
+ }
+@@ -1167,7 +1167,7 @@ void driver(FILE* ref_gtf, FILE* mask_gtf, vector<string>& sam_hit_filename_list
+ //shared_ptr<vector<shared_ptr<SampleAbundances> > > abundances(new vector<shared_ptr<SampleAbundances> >());
+ quantitate_next_locus(rt, bundle_factories, test_launcher);
+ bool more_loci_remain = false;
+- foreach (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
++ for_each (shared_ptr<ReplicatedBundleFactory> rep_fac, bundle_factories)
+ {
+ if (rep_fac->bundles_remain())
+ {
+diff --git a/src/cufflinks.cpp b/src/cufflinks.cpp
+index 796af98..1030ae8 100644
+--- a/src/cufflinks.cpp
++++ b/src/cufflinks.cpp
+@@ -471,7 +471,7 @@ void combine_strand_assemblies(vector<Scaffold>& lhs,
+ {
+ for(size_t l = 0; l < lhs.size(); ++l)
+ {
+- foreach(shared_ptr<Scaffold> ref_scaff, *ref_scaffs)
++ for_each(shared_ptr<Scaffold> ref_scaff, *ref_scaffs)
+ {
+ // if we're past all the overlaps, just stop
+ if (ref_scaff->left() >= lhs[l].right() + overhang_3)
+@@ -504,7 +504,7 @@ void combine_strand_assemblies(vector<Scaffold>& lhs,
+ }
+ for(size_t r = 0; r < rhs.size(); ++r)
+ {
+- foreach(shared_ptr<Scaffold> ref_scaff, *ref_scaffs)
++ for_each(shared_ptr<Scaffold> ref_scaff, *ref_scaffs)
+ {
+ if (ref_scaff->left() >= rhs[r].right() + overhang_3)
+ {
+@@ -665,7 +665,7 @@ bool scaffolds_for_bundle(const HitBundle& bundle,
+ if (ref_guided && enable_faux_reads && !hits.empty())
+ {
+ vector<Scaffold> pseudohits;
+- foreach(shared_ptr<Scaffold const> ref_scaff, *ref_scaffs)
++ for_each(shared_ptr<Scaffold const> ref_scaff, *ref_scaffs)
+ {
+ ref_scaff->tile_with_scaffs(pseudohits, tile_len, tile_off);
+ }
+@@ -842,7 +842,7 @@ bool scaffolds_for_bundle(const HitBundle& bundle,
+ }
+ if (assembled_successfully)
+ {
+- foreach(Scaffold& scaff, tmp_scaffs)
++ for_each(Scaffold& scaff, tmp_scaffs)
+ {
+ scaffolds.push_back(shared_ptr<Scaffold>(new Scaffold(scaff)));
+ }
+@@ -886,7 +886,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+
+ // need the avg read length for depth of coverage calculation
+ double avg_read_length = 0;
+- foreach (MateHit& hit, hits_in_cluster)
++ for_each (MateHit& hit, hits_in_cluster)
+ {
+ if (hit.left_alignment())
+ avg_read_length += hit.left_alignment()->read_len();
+@@ -905,7 +905,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ }
+ else
+ {
+- foreach(shared_ptr<Abundance> ab, transfrag_cluster.abundances())
++ for_each(shared_ptr<Abundance> ab, transfrag_cluster.abundances())
+ {
+ ab->status(NUMERIC_HI_DATA);
+ }
+@@ -939,7 +939,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ {
+ shared_ptr<Abundance> ab_i = abundances[i];
+ bool found = false;
+- foreach (shared_ptr<Abundance> ab_j, filtered_transcripts)
++ for_each (shared_ptr<Abundance> ab_j, filtered_transcripts)
+ {
+ if (ab_i == ab_j)
+ {
+@@ -961,7 +961,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ transfrags_by_strand);
+
+
+- foreach (const AbundanceGroup& strand_group, transfrags_by_strand)
++ for_each (const AbundanceGroup& strand_group, transfrags_by_strand)
+ {
+ vector<AbundanceGroup> transfrags_by_gene;
+
+@@ -974,7 +974,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ cluster_transcripts<ConnectByExonOverlap>(strand_group, transfrags_by_gene);
+ }
+
+- foreach(const AbundanceGroup& gene, transfrags_by_gene)
++ for_each(const AbundanceGroup& gene, transfrags_by_gene)
+ {
+ const vector<shared_ptr<Abundance> >& iso_abundances = gene.abundances();
+ vector<Isoform> isoforms;
+@@ -985,7 +985,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ string ref_gene_id = "";
+
+ double major_isoform_FPKM = 0;
+- foreach (shared_ptr<Abundance> iso_ab, iso_abundances)
++ for_each (shared_ptr<Abundance> iso_ab, iso_abundances)
+ {
+ if (iso_ab->transfrag()->is_ref())
+ {
+@@ -1002,7 +1002,7 @@ void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
+ major_isoform_FPKM = max(iso_ab->FPKM(), major_isoform_FPKM);
+ }
+
+- foreach (shared_ptr<Abundance> iso_ab, iso_abundances)
++ for_each (shared_ptr<Abundance> iso_ab, iso_abundances)
+ {
+ // Calculate transcript depth of coverage and FMI from FPKM
+ double FPKM = iso_ab->FPKM();
+@@ -1067,7 +1067,7 @@ void quantitate_transcript_clusters(vector<shared_ptr<Scaffold> >& scaffolds,
+ {
+ vector<Scaffold> c;
+ scaffolds[i]->get_complete_subscaffolds(c);
+- foreach (Scaffold& s, c)
++ for_each (Scaffold& s, c)
+ {
+ split_partials.push_back(shared_ptr<Scaffold>(new Scaffold(s)));
+ }
+@@ -1076,7 +1076,7 @@ void quantitate_transcript_clusters(vector<shared_ptr<Scaffold> >& scaffolds,
+ scaffolds = split_partials;
+
+ vector<shared_ptr<Abundance> > abundances;
+- foreach(shared_ptr<Scaffold> s, scaffolds)
++ for_each(shared_ptr<Scaffold> s, scaffolds)
+ {
+ TranscriptAbundance* pT = new TranscriptAbundance;
+ pT->transfrag(s);
+@@ -1091,7 +1091,7 @@ void quantitate_transcript_clusters(vector<shared_ptr<Scaffold> >& scaffolds,
+ cluster_transcripts<ConnectByExonOverlap>(transfrags,
+ transfrags_by_cluster);
+
+- foreach(AbundanceGroup& cluster, transfrags_by_cluster)
++ for_each(AbundanceGroup& cluster, transfrags_by_cluster)
+ {
+ quantitate_transcript_cluster(cluster, total_map_mass, genes, bundle_too_large);
+ }
+@@ -1233,10 +1233,10 @@ void assemble_bundle(const RefSequenceTable& rt,
+ if (init_bundle_mode == REF_GUIDED)
+ {
+ hit_introns = new set<AugmentedCuffOp>();
+- foreach(const MateHit& h, bundle.non_redundant_hits())
++ for_each(const MateHit& h, bundle.non_redundant_hits())
+ {
+ Scaffold s(h);
+- foreach (AugmentedCuffOp a, s.augmented_ops())
++ for_each (AugmentedCuffOp a, s.augmented_ops())
+ {
+ if (a.opcode == CUFF_INTRON)
+ {
+@@ -1567,7 +1567,7 @@ void driver(const string& hit_file_name, FILE* ref_gtf, FILE* mask_gtf)
+ verbose_msg("%d ReadHits still live\n", num_deleted);
+ verbose_msg("Found %lu reference contigs\n", rt.size());
+
+- foreach(shared_ptr<Scaffold> ref_scaff, ref_mRNAs)
++ for_each(shared_ptr<Scaffold> ref_scaff, ref_mRNAs)
+ {
+ ref_scaff->clear_hits();
+ }
+diff --git a/src/differential.cpp b/src/differential.cpp
+index 3e5cff0..6b108cb 100644
+--- a/src/differential.cpp
++++ b/src/differential.cpp
+@@ -84,7 +84,7 @@ void TestLauncher::abundance_avail(const string& locus_id,
+ // acquire the lock itself.
+ bool TestLauncher::all_samples_reported_in(vector<shared_ptr<SampleAbundances> >& abundances)
+ {
+- foreach (shared_ptr<SampleAbundances> ab, abundances)
++ for_each (shared_ptr<SampleAbundances> ab, abundances)
+ {
+ if (!ab)
+ {
+@@ -436,7 +436,7 @@ pair<int, SampleDiffs::iterator> get_de_tests(const string& description,
+ // ublas::vector<double> null_kappa_mean;
+ // null_kappa_mean = ublas::zero_vector<double>(curr_kappa_cov.size1());
+ //
+-// foreach(ublas::vector<double>& sample, samples)
++// for_each(ublas::vector<double>& sample, samples)
+ // {
+ // null_kappa_mean += sample;
+ // }
+@@ -1056,7 +1056,7 @@ void sample_abundance_worker(const string& locus_tag,
+ {
+ vector<shared_ptr<Abundance> > abundances;
+
+- foreach(shared_ptr<Scaffold> s, sample_bundle->ref_scaffolds())
++ for_each(shared_ptr<Scaffold> s, sample_bundle->ref_scaffolds())
+ {
+ TranscriptAbundance* pT = new TranscriptAbundance;
+ pT->transfrag(s);
+@@ -1082,7 +1082,7 @@ void sample_abundance_worker(const string& locus_tag,
+ }
+ else
+ {
+- foreach(shared_ptr<Abundance> ab, abundances)
++ for_each(shared_ptr<Abundance> ab, abundances)
+ {
+ ab->status(NUMERIC_HI_DATA);
+ }
+@@ -1093,7 +1093,7 @@ void sample_abundance_worker(const string& locus_tag,
+ cluster_transcripts<ConnectByAnnotatedGeneId>(sample.transcripts,
+ transcripts_by_gene_id);
+
+- foreach(AbundanceGroup& ab_group, transcripts_by_gene_id)
++ for_each(AbundanceGroup& ab_group, transcripts_by_gene_id)
+ {
+ ab_group.locus_tag(locus_tag);
+ set<string> gene_ids = ab_group.gene_id();
+@@ -1119,7 +1119,7 @@ void sample_abundance_worker(const string& locus_tag,
+ &cds_count_cov,
+ &cds_fpkm_cov,
+ &cds_gamma_boot_cov);
+- foreach(AbundanceGroup& ab_group, transcripts_by_cds)
++ for_each(AbundanceGroup& ab_group, transcripts_by_cds)
+ {
+ ab_group.locus_tag(locus_tag);
+ set<string> protein_ids = ab_group.protein_id();
+@@ -1135,7 +1135,7 @@ void sample_abundance_worker(const string& locus_tag,
+ vector<shared_ptr<Abundance> > cds_abundances;
+ double max_cds_mass_variance = 0.0;
+ set<shared_ptr<ReadGroupProperties const> > rg_props;
+- foreach (AbundanceGroup& ab_group, sample.cds)
++ for_each (AbundanceGroup& ab_group, sample.cds)
+ {
+ cds_abundances.push_back(shared_ptr<Abundance>(new AbundanceGroup(ab_group)));
+ max_cds_mass_variance = max(ab_group.max_mass_variance(), max_cds_mass_variance);
+@@ -1155,7 +1155,7 @@ void sample_abundance_worker(const string& locus_tag,
+ cluster_transcripts<ConnectByAnnotatedGeneId>(cds,
+ cds_by_gene);
+
+- foreach(AbundanceGroup& ab_group, cds_by_gene)
++ for_each(AbundanceGroup& ab_group, cds_by_gene)
+ {
+ ab_group.locus_tag(locus_tag);
+ set<string> gene_ids = ab_group.gene_id();
+@@ -1185,7 +1185,7 @@ void sample_abundance_worker(const string& locus_tag,
+ &tss_gamma_boot_cov);
+
+
+- foreach(AbundanceGroup& ab_group, transcripts_by_tss)
++ for_each(AbundanceGroup& ab_group, transcripts_by_tss)
+ {
+ ab_group.locus_tag(locus_tag);
+ set<string> tss_ids = ab_group.tss_id();
+@@ -1202,7 +1202,7 @@ void sample_abundance_worker(const string& locus_tag,
+ // Group TSS clusters by gene
+ vector<shared_ptr<Abundance> > primary_transcript_abundances;
+ set<shared_ptr<ReadGroupProperties const> > rg_props;
+- foreach (AbundanceGroup& ab_group, sample.primary_transcripts)
++ for_each (AbundanceGroup& ab_group, sample.primary_transcripts)
+ {
+ primary_transcript_abundances.push_back(shared_ptr<Abundance>(new AbundanceGroup(ab_group)));
+ max_tss_mass_variance = max(max_tss_mass_variance, ab_group.max_mass_variance());
+@@ -1223,13 +1223,13 @@ void sample_abundance_worker(const string& locus_tag,
+ cluster_transcripts<ConnectByAnnotatedGeneId>(primary_transcripts,
+ primary_transcripts_by_gene);
+
+- foreach(AbundanceGroup& ab_group, primary_transcripts_by_gene)
++ for_each(AbundanceGroup& ab_group, primary_transcripts_by_gene)
+ {
+ ab_group.locus_tag(locus_tag);
+ set<string> gene_ids = ab_group.gene_id();
+ // if (gene_ids.size() > 1)
+ // {
+-// foreach (string st, gene_ids)
++// for_each (string st, gene_ids)
+ // {
+ // fprintf(stderr, "%s\n", st.c_str());
+ // }
+@@ -1314,7 +1314,7 @@ void sample_worker(const RefSequenceTable& rt,
+ bool perform_cds_analysis = final_est_run;
+ bool perform_tss_analysis = final_est_run;
+
+- foreach(shared_ptr<Scaffold> s, bundle.ref_scaffolds())
++ for_each(shared_ptr<Scaffold> s, bundle.ref_scaffolds())
+ {
+ if (s->annotated_tss_id() == "")
+ {
+@@ -1439,7 +1439,7 @@ void sample_worker(const RefSequenceTable& rt,
+ ///////////////////////////////////////////////
+
+
+- foreach(shared_ptr<Scaffold> ref_scaff, bundle.ref_scaffolds())
++ for_each(shared_ptr<Scaffold> ref_scaff, bundle.ref_scaffolds())
+ {
+ ref_scaff->clear_hits();
+ }
+@@ -1465,7 +1465,7 @@ void dump_locus_variance_info(const string& filename)
+
+ fprintf(fdump,
+ "condition\tdescription\tlocus_counts\tempir_var\tlocus_fit_var\tsum_iso_fit_var\tcross_replicate_js\tnum_transcripts\tbayes_gamma_trace\tempir_gamma_trace\tcount_mean\tgamma_var\tgamma_bootstrap_var\tlocus_salient_frags\tlocus_total_frags\tcount_sharing\n");
+- foreach (LocusVarianceInfo& L, locus_variance_info_table)
++ for_each (LocusVarianceInfo& L, locus_variance_info_table)
+ {
+ for (size_t i = 0; i < L.gamma.size(); ++i)
+ {
+@@ -1503,22 +1503,22 @@ void test_differential(const string& locus_tag,
+ for (size_t i = 0; i < samples.size(); ++i)
+ {
+ const AbundanceGroup& ab_group = samples[i]->transcripts;
+- foreach (shared_ptr<Abundance> ab, ab_group.abundances())
++ for_each (shared_ptr<Abundance> ab, ab_group.abundances())
+ {
+ add_to_tracking_table(i, *ab, tracking.isoform_fpkm_tracking);
+ }
+
+- foreach (AbundanceGroup& ab, samples[i]->cds)
++ for_each (AbundanceGroup& ab, samples[i]->cds)
+ {
+ add_to_tracking_table(i, ab, tracking.cds_fpkm_tracking);
+ }
+
+- foreach (AbundanceGroup& ab, samples[i]->primary_transcripts)
++ for_each (AbundanceGroup& ab, samples[i]->primary_transcripts)
+ {
+ add_to_tracking_table(i, ab, tracking.tss_group_fpkm_tracking);
+ }
+
+- foreach (AbundanceGroup& ab, samples[i]->genes)
++ for_each (AbundanceGroup& ab, samples[i]->genes)
+ {
+ add_to_tracking_table(i, ab, tracking.gene_fpkm_tracking);
+ }
+diff --git a/src/filters.cpp b/src/filters.cpp
+index 0a10b50..5ab31e0 100644
+--- a/src/filters.cpp
++++ b/src/filters.cpp
+@@ -752,7 +752,7 @@ void clip_by_3_prime_dropoff(vector<Scaffold>& scaffolds)
+
+ if (library_type != "transfrags")
+ {
+- foreach (Scaffold& scaff, scaffolds)
++ for_each (Scaffold& scaff, scaffolds)
+ {
+ if (!(scaff.strand() == CUFF_FWD || scaff.strand() == CUFF_REV))
+ continue;
+@@ -761,7 +761,7 @@ void clip_by_3_prime_dropoff(vector<Scaffold>& scaffolds)
+ vector<double> coverage(scaff_len, 0.0);
+
+ double total = 0;
+- foreach(const MateHit* hit, scaff.mate_hits())
++ for_each(const MateHit* hit, scaff.mate_hits())
+ {
+ int start, end, frag_len;
+ if (!scaff.map_frag(*hit, start, end, frag_len)) continue;
+@@ -906,7 +906,7 @@ void clip_by_3_prime_dropoff(vector<Scaffold>& scaffolds)
+ }
+ else
+ {
+- foreach (Scaffold& scaff, scaffolds)
++ for_each (Scaffold& scaff, scaffolds)
+ {
+ if (!(scaff.strand() == CUFF_FWD || scaff.strand() == CUFF_REV))
+ continue;
+@@ -915,7 +915,7 @@ void clip_by_3_prime_dropoff(vector<Scaffold>& scaffolds)
+ vector<double> coverage(scaff_len, 0.0);
+
+ double total = 0;
+- foreach(const MateHit* hit, scaff.mate_hits())
++ for_each(const MateHit* hit, scaff.mate_hits())
+ {
+ int start, end, frag_len;
+ if (!scaff.map_frag(*hit, start, end, frag_len)) continue;
+diff --git a/src/genes.h b/src/genes.h
+index 4dfa996..eb48a14 100644
+--- a/src/genes.h
++++ b/src/genes.h
+@@ -169,7 +169,7 @@ public:
+
+ bool has_ref_trans() const
+ {
+- foreach (const Isoform& iso, _isoforms)
++ for_each (const Isoform& iso, _isoforms)
+ {
+ if (iso.is_ref_trans())
+ return true;
+@@ -180,7 +180,7 @@ public:
+ double estimated_count() const
+ {
+ double est = 0.0;
+- foreach (const Isoform& iso, _isoforms)
++ for_each (const Isoform& iso, _isoforms)
+ {
+ est += iso.estimated_count();
+ }
+@@ -191,7 +191,7 @@ public:
+ {
+ double eff = 0.0;
+ double total_fpkm = 0;
+- foreach (const Isoform& iso, _isoforms)
++ for_each (const Isoform& iso, _isoforms)
+ {
+ eff += iso.FPKM() * iso.effective_length();
+ total_fpkm += iso.FPKM();
+diff --git a/src/gtf_to_sam.cpp b/src/gtf_to_sam.cpp
+index 12f70c1..f52d40a 100644
+--- a/src/gtf_to_sam.cpp
++++ b/src/gtf_to_sam.cpp
+@@ -241,13 +241,13 @@ void set_relative_fpkms(vector<shared_ptr<Scaffold> >& ref_mRNAs)
+ vector<shared_ptr<Scaffold> >& gene = grouped_scaffolds[i];
+
+ double total_fpkm = 0.0;
+- foreach(shared_ptr<Scaffold> scaff, gene)
++ for_each(shared_ptr<Scaffold> scaff, gene)
+ {
+ total_fpkm += scaff->fpkm();
+ }
+ if (total_fpkm > 0)
+ {
+- foreach (shared_ptr<Scaffold> scaff, gene)
++ for_each (shared_ptr<Scaffold> scaff, gene)
+ {
+ scaff->fpkm(scaff->fpkm() / total_fpkm);
+ }
+@@ -263,7 +263,7 @@ void driver(vector<FILE*> ref_gtf_files, FILE* sam_out)
+ vector<vector<shared_ptr<Scaffold> > > ref_mRNA_table;
+ vector<pair<string, vector<double> > > sample_count_table;
+
+- foreach (FILE* ref_gtf, ref_gtf_files)
++ for_each (FILE* ref_gtf, ref_gtf_files)
+ {
+ vector<shared_ptr<Scaffold> > ref_mRNAs;
+ ::load_ref_rnas(ref_gtf, rt, ref_mRNAs, false, true);
+@@ -314,7 +314,7 @@ int main(int argc, char** argv)
+
+ vector<FILE*> ref_gtf_files;
+
+- foreach (const string& ref_gtf_in_filename, ref_gtf_filenames)
++ for_each (const string& ref_gtf_in_filename, ref_gtf_filenames)
+ {
+ FILE* ref_gtf = NULL;
+ if (ref_gtf_in_filename != "")
+diff --git a/src/hits.cpp b/src/hits.cpp
+index 910ba0f..dc81813 100644
+--- a/src/hits.cpp
++++ b/src/hits.cpp
+@@ -233,7 +233,7 @@ void collapse_hits(const vector<MateHit>& hits,
+ non_redundant.erase(new_end, non_redundant.end());
+ non_redundant.resize(non_redundant.size());
+
+- foreach(MateHit& hit, non_redundant)
++ for_each(MateHit& hit, non_redundant)
+ hit.collapse_mass(0);
+
+ size_t curr_aln = 0;
+@@ -252,7 +252,7 @@ void collapse_hits(const vector<MateHit>& hits,
+ ++curr_aln;
+ }
+
+- //foreach(MateHit& hit, non_redundant)
++ //for_each(MateHit& hit, non_redundant)
+ //assert(hit.collapse_mass() <= 1 || !hit.is_multi());
+
+ //non_redundant.erase(remove_if(non_redundant.begin(),non_redundant.end(),has_no_collapse_mass), non_redundant.end());
+diff --git a/src/replicates.cpp b/src/replicates.cpp
+index 634f209..ec8ce9c 100644
+--- a/src/replicates.cpp
++++ b/src/replicates.cpp
+@@ -236,7 +236,7 @@ fit_dispersion_model_helper(const string& condition_name,
+ mean /= p.counts.size();
+
+ double var = 0.0;
+- foreach (double d, p.counts)
++ for_each (double d, p.counts)
+ {
+ var += (d - mean) * (d - mean);
+ }
+@@ -363,7 +363,7 @@ fit_dispersion_model(const string& condition_name,
+ ProgressBar p_bar("Modeling fragment count overdispersion.",0);
+
+ int max_transcripts = 0;
+- foreach(const LocusCountList& L, sample_count_table)
++ for_each(const LocusCountList& L, sample_count_table)
+ {
+ if (L.num_transcripts > max_transcripts)
+ {
+@@ -382,7 +382,7 @@ fit_dispersion_model(const string& condition_name,
+ if (i != 0)
+ {
+ // vector<LocusCountList> sample_count_subtable;
+-// foreach(const LocusCountList& L, sample_count_table)
++// for_each(const LocusCountList& L, sample_count_table)
+ // {
+ // if (L.num_transcripts == i)
+ // {
+diff --git a/src/replicates.h b/src/replicates.h
+index ca4484f..73d339c 100644
+--- a/src/replicates.h
++++ b/src/replicates.h
+@@ -99,7 +99,7 @@ public:
+ #if ENABLE_THREADS
+ boost::mutex::scoped_lock lock(_rep_factory_lock);
+ #endif
+- foreach (boost::shared_ptr<BundleFactory> fac, _factories)
++ for_each (boost::shared_ptr<BundleFactory> fac, _factories)
+ {
+ if (fac->bundles_remain())
+ return true;
+@@ -115,7 +115,7 @@ public:
+ std::vector<HitBundle*> bundles;
+
+ bool non_empty_bundle = false;
+- foreach (boost::shared_ptr<BundleFactory> fac, _factories)
++ for_each (boost::shared_ptr<BundleFactory> fac, _factories)
+ {
+ bundles.push_back(new HitBundle());
+ if (fac->next_bundle(*(bundles.back())))
+@@ -126,7 +126,7 @@ public:
+
+ if (non_empty_bundle == false)
+ {
+- foreach (HitBundle* in_bundle, bundles)
++ for_each (HitBundle* in_bundle, bundles)
+ {
+ in_bundle->ref_scaffolds().clear();
+ in_bundle->clear_hits();
+@@ -149,7 +149,7 @@ public:
+ // Merge the replicates into a combined bundle of hits.
+ HitBundle::combine(bundles, bundle_out);
+
+- foreach (HitBundle* in_bundle, bundles)
++ for_each (HitBundle* in_bundle, bundles)
+ {
+ in_bundle->ref_scaffolds().clear();
+ in_bundle->clear_hits();
+@@ -163,7 +163,7 @@ public:
+ #if ENABLE_THREADS
+ boost::mutex::scoped_lock lock(_rep_factory_lock);
+ #endif
+- foreach (shared_ptr<BundleFactory> fac, _factories)
++ for_each (shared_ptr<BundleFactory> fac, _factories)
+ {
+ fac->reset();
+ }
+@@ -246,7 +246,7 @@ public:
+ shared_ptr<MassDispersionModel const> disperser;
+ disperser = fit_dispersion_model(_condition_name,scale_factors, sample_count_table);
+
+- foreach (shared_ptr<BundleFactory> fac, _factories)
++ for_each (shared_ptr<BundleFactory> fac, _factories)
+ {
+ shared_ptr<ReadGroupProperties> rg_props = fac->read_group_properties();
+ rg_props->mass_dispersion_model(disperser);
+@@ -260,7 +260,7 @@ public:
+ #if ENABLE_THREADS
+ boost::mutex::scoped_lock lock(_rep_factory_lock);
+ #endif
+- foreach(shared_ptr<BundleFactory> fac, _factories)
++ for_each(shared_ptr<BundleFactory> fac, _factories)
+ {
+ fac->set_ref_rnas(mRNAs);
+ }
+@@ -271,7 +271,7 @@ public:
+ #if ENABLE_THREADS
+ boost::mutex::scoped_lock lock(_rep_factory_lock);
+ #endif
+- foreach(shared_ptr<BundleFactory> fac, _factories)
++ for_each(shared_ptr<BundleFactory> fac, _factories)
+ {
+ fac->set_mask_rnas(mRNAs);
+ }
+@@ -284,7 +284,7 @@ public:
+ #if ENABLE_THREADS
+ boost::mutex::scoped_lock lock(_rep_factory_lock);
+ #endif
+- foreach(shared_ptr<BundleFactory>& fac, _factories)
++ for_each(shared_ptr<BundleFactory>& fac, _factories)
+ {
+ fac->read_group_properties()->mass_dispersion_model(disperser);
+ }
+diff --git a/src/scaffolds.cpp b/src/scaffolds.cpp
+index 096f58a..c12118e 100644
+--- a/src/scaffolds.cpp
++++ b/src/scaffolds.cpp
+@@ -620,7 +620,7 @@ void Scaffold::tile_with_scaffs(vector<Scaffold>& tile_scaffs, int max_len, int
+
+ // genomic_offset actually could be zero - from an exon starting at coord
+ // 1 in some chromosome of the ref.
+-// foreach(const AugmentedCuffOp& op, ops)
++// for_each(const AugmentedCuffOp& op, ops)
+ // {
+ // assert (op.genomic_offset != 0);
+ // }
+@@ -819,7 +819,7 @@ void Scaffold::merge(const vector<Scaffold>& s,
+ if (library_type == "transfrags")
+ {
+ double avg_fpkm = 0.0;
+- foreach (const Scaffold& sc, s)
++ for_each (const Scaffold& sc, s)
+ {
+ avg_fpkm += sc.fpkm();
+ }
+@@ -871,7 +871,7 @@ void Scaffold::fill_gaps(const vector<AugmentedCuffOp>& filler)
+
+ vector<AugmentedCuffOp> tmp_filler = filler;
+
+- foreach(const AugmentedCuffOp& op, orig_ops)
++ for_each(const AugmentedCuffOp& op, orig_ops)
+ {
+ assert (op.g_left() < op.g_right());
+
+@@ -888,7 +888,7 @@ void Scaffold::fill_gaps(const vector<AugmentedCuffOp>& filler)
+ AugmentedCuffOp::merge_ops(tmp_filler, padded_filler, false);
+
+ vector<AugmentedCuffOp> overlapping;
+- foreach (const AugmentedCuffOp& op, padded_filler)
++ for_each (const AugmentedCuffOp& op, padded_filler)
+ {
+ //if (left() <= op.g_left() && right() >= op.g_right()
+ if(::overlap_in_genome(op.g_left(),op.g_right(), left(), right())
+@@ -1630,7 +1630,7 @@ void Scaffold::get_complete_subscaffolds(vector<Scaffold>& complete)
+
+ // const vector<const MateHit*>& hits = known.mate_hits();
+ // bool contains_spliced_hit = false;
+- // foreach (const MateHit* h, hits)
++ // for_each (const MateHit* h, hits)
+ // {
+ // const ReadHit* left = h->left_alignment();
+ // const ReadHit* right = h->right_alignment();
+@@ -1670,7 +1670,7 @@ double Scaffold::internal_exon_coverage() const
+ int left = augmented_ops()[2].g_left();
+ int right = augmented_ops()[augmented_ops().size() - 3].g_right();
+ vector<bool> covered(right-left, 0);
+- foreach(const MateHit* h, mate_hits())
++ for_each(const MateHit* h, mate_hits())
+ {
+ if (::overlap_in_genome(h->left(),h->right(), left, right))
+ {
+@@ -1694,7 +1694,7 @@ bool Scaffold::has_strand_support(vector<shared_ptr<Scaffold> >* ref_scaffs) con
+ if (has_intron())
+ return true;
+
+- foreach (const MateHit* h, mate_hits())
++ for_each (const MateHit* h, mate_hits())
+ {
+ if (h->strand() == strand())
+ return true;
+@@ -1704,7 +1704,7 @@ bool Scaffold::has_strand_support(vector<shared_ptr<Scaffold> >* ref_scaffs) con
+ if (ref_scaffs == NULL)
+ return false;
+
+- foreach (shared_ptr<Scaffold const> ref_scaff, *ref_scaffs)
++ for_each (shared_ptr<Scaffold const> ref_scaff, *ref_scaffs)
+ {
+ if (ref_scaff->strand() == strand() && exons_overlap(*this, *ref_scaff))
+ return true;
+@@ -1729,10 +1729,10 @@ bool Scaffold::hits_support_introns() const
+ {
+ set<AugmentedCuffOp> hit_introns;
+ set<AugmentedCuffOp> scaffold_introns;
+- foreach(const MateHit* h, _mates_in_scaff)
++ for_each(const MateHit* h, _mates_in_scaff)
+ {
+ Scaffold s(*h);
+- foreach (AugmentedCuffOp a, s.augmented_ops())
++ for_each (AugmentedCuffOp a, s.augmented_ops())
+ {
+ if (a.opcode == CUFF_INTRON)
+ {
+@@ -1740,7 +1740,7 @@ bool Scaffold::hits_support_introns() const
+ }
+ }
+ }
+- foreach (AugmentedCuffOp a, _augmented_ops)
++ for_each (AugmentedCuffOp a, _augmented_ops)
+ {
+ if (a.opcode == CUFF_INTRON)
+ {
+@@ -1751,13 +1751,13 @@ bool Scaffold::hits_support_introns() const
+ if (hit_introns != scaffold_introns)
+ {
+ fprintf(stderr, "********************\n");
+- foreach(const AugmentedCuffOp& a, hit_introns)
++ for_each(const AugmentedCuffOp& a, hit_introns)
+ {
+ fprintf(stderr, "%d - %d\n", a.g_left(), a.g_right());
+ }
+
+ fprintf(stderr, "####################\n");
+- foreach(const AugmentedCuffOp& a, scaffold_introns)
++ for_each(const AugmentedCuffOp& a, scaffold_introns)
+ {
+ fprintf(stderr, "%d - %d\n", a.g_left(), a.g_right());
+ }
+@@ -1770,7 +1770,7 @@ bool Scaffold::hits_support_introns(set<AugmentedCuffOp>& hit_introns) const
+ {
+ set<AugmentedCuffOp> scaffold_introns;
+
+- foreach (AugmentedCuffOp a, _augmented_ops)
++ for_each (AugmentedCuffOp a, _augmented_ops)
+ {
+ if (a.opcode == CUFF_INTRON)
+ {
+diff --git a/src/scaffolds.h b/src/scaffolds.h
+index 0f29e80..f8410f7 100644
+--- a/src/scaffolds.h
++++ b/src/scaffolds.h
+@@ -314,7 +314,7 @@ public:
+ if (library_type == "transfrags")
+ {
+ double avg_fpkm = 0.0;
+- foreach (const Scaffold& sc, hits)
++ for_each (const Scaffold& sc, hits)
+ {
+ avg_fpkm += sc.fpkm();
+ }
diff --git a/sci-biology/cufflinks/files/cufflinks-1.3.0-gcc-4.7.patch b/sci-biology/cufflinks/files/cufflinks-1.3.0-gcc-4.7.patch
new file mode 100644
index 000000000000..360e9c1a11b8
--- /dev/null
+++ b/sci-biology/cufflinks/files/cufflinks-1.3.0-gcc-4.7.patch
@@ -0,0 +1,20 @@
+ src/lemon/bits/base_extender.h | 4 ++--
+ 1 file changed, 2 insertions(+), 2 deletions(-)
+
+diff --git a/src/lemon/bits/base_extender.h b/src/lemon/bits/base_extender.h
+index 84bb242..b812247 100644
+--- a/src/lemon/bits/base_extender.h
++++ b/src/lemon/bits/base_extender.h
+@@ -359,10 +359,10 @@ namespace lemon {
+ }
+
+ Node source(const UEdge& edge) const {
+- return aNode(edge);
++ return this->aNode(edge);
+ }
+ Node target(const UEdge& edge) const {
+- return bNode(edge);
++ return this->bNode(edge);
+ }
+
+ void firstInc(UEdge& edge, bool& dir, const Node& node) const {
diff --git a/sci-biology/cufflinks/files/cufflinks-2.2.1-flags.patch b/sci-biology/cufflinks/files/cufflinks-2.2.1-flags.patch
new file mode 100644
index 000000000000..47784088fab9
--- /dev/null
+++ b/sci-biology/cufflinks/files/cufflinks-2.2.1-flags.patch
@@ -0,0 +1,28 @@
+ configure.ac | 7 ++++---
+ 1 file changed, 4 insertions(+), 3 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 96ffbac..e88b8e4 100755
+--- a/configure.ac
++++ b/configure.ac
+@@ -61,7 +61,8 @@ AC_CANONICAL_HOST
+
+ # set CFLAGS and CXXFLAGS
+ user_CFLAGS=${CFLAGS}
+-generic_CFLAGS="-Wall -Wno-strict-aliasing -g -gdwarf-2 -Wunused -Wuninitialized -ftemplate-depth-1024"
++generic_CFLAGS="-Wall -Wno-strict-aliasing -Wunused -Wuninitialized"
++generic_CXXFLAGS="-Wall -Wno-strict-aliasing -Wunused -Wuninitialized -ftemplate-depth-1024"
+ ext_CFLAGS=""
+ debug_CFLAGS=""
+ #echo "${host_cpu}-${host_os}"
+@@ -106,8 +107,8 @@ AC_ARG_ENABLE(profiling, [ --enable-profiling enable profiling with
+ [ext_LDFLAGS="-lprofiler -ltcmalloc"], [])
+
+ CFLAGS="${generic_CFLAGS} ${ext_CFLAGS} ${user_CFLAGS} ${debug_CFLAGS} ${OPENMP_CFLAGS}"
+-CXXFLAGS="$CFLAGS"
+-CXXFLAGS="${CXXFLAGS} ${BOOST_CPPFLAGS} ${BAM_CPPFLAGS} ${EIGEN_CPPFLAGS}"
++CXXFLAGS="${generic_CFLAGS} ${CXXFLAGS}"
++CPPFLAGS="${CPPFLAGS} ${BOOST_CPPFLAGS} ${BAM_CPPFLAGS} ${EIGEN_CPPFLAGS}"
+ user_LDFLAGS="$LDFLAGS"
+ LDFLAGS="${ext_LDFLAGS} ${user_LDFLAGS}"
+
diff --git a/sci-biology/cufflinks/files/cufflinks-2.2.1-hts.patch b/sci-biology/cufflinks/files/cufflinks-2.2.1-hts.patch
new file mode 100644
index 000000000000..3b9abd812680
--- /dev/null
+++ b/sci-biology/cufflinks/files/cufflinks-2.2.1-hts.patch
@@ -0,0 +1,16 @@
+ ax_bam.m4 | 2 +-
+ 1 file changed, 1 insertion(+), 1 deletion(-)
+
+diff --git a/ax_bam.m4 b/ax_bam.m4
+index 7d463b7..95f1bed 100644
+--- a/ax_bam.m4
++++ b/ax_bam.m4
+@@ -189,7 +189,7 @@ if test "x$want_bam" = "xyes"; then
+ AC_MSG_NOTICE([Your bam libraries seem too old (version $_version).])
+ fi
+ else
+- BAM_LIB="-lbam"
++ BAM_LIB="-lbam -lhts"
+ AC_SUBST(BAM_CPPFLAGS)
+ AC_SUBST(BAM_LDFLAGS)
+ AC_SUBST(BAM_LIB)
diff --git a/sci-biology/cufflinks/metadata.xml b/sci-biology/cufflinks/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/cufflinks/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/cutg/Manifest b/sci-biology/cutg/Manifest
new file mode 100644
index 000000000000..5c0e901d9aba
--- /dev/null
+++ b/sci-biology/cutg/Manifest
@@ -0,0 +1 @@
+DIST cutg-160.tar.xz 178015420 SHA256 faa2e5e4417e5cadd67bfff0c011f2f3e2e0c5d8b324fc441f9346808f6ed1fa SHA512 9b72283f311fb805b7b22f59f3ca8fed2ab0af72b82247900922999792c1b112dcaca9b29b265a1e0e7b9eaf9ff846a1dc4c196fb95ddbfb3ee5175755ffb8e7 WHIRLPOOL 540f9ba9f2f69718688531c85729c567cd6ba260f12d23b5f3c00d9689da93aefab588fe3dd926defacf4a21982406055ebee413e39ce53a2916e5e571037e93
diff --git a/sci-biology/cutg/cutg-160-r1.ebuild b/sci-biology/cutg/cutg-160-r1.ebuild
new file mode 100644
index 000000000000..46163bc2a80f
--- /dev/null
+++ b/sci-biology/cutg/cutg-160-r1.ebuild
@@ -0,0 +1,50 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+DESCRIPTION="Codon usage tables calculated from GenBank"
+HOMEPAGE="http://www.kazusa.or.jp/codon/"
+SRC_URI="http://dev.gentoo.org/~jlec/distfiles/${P}.tar.xz"
+
+SLOT="0"
+LICENSE="public-domain"
+# Minimal build keeps only the indexed files (if applicable) and the
+# documentation. The non-indexed database is not installed.
+IUSE="emboss minimal"
+KEYWORDS="amd64 ppc x86 ~amd64-linux ~x86-linux ~ppc-macos ~sparc-solaris"
+
+DEPEND="emboss? ( sci-biology/emboss )"
+RDEPEND="${DEPEND}"
+
+RESTRICT="binchecks strip"
+
+src_compile() {
+ if use emboss; then
+ mkdir CODONS || die
+ ebegin "Indexing CUTG for usage with EMBOSS."
+ EMBOSS_DATA="." cutgextract -auto -directory "${S}" || die \
+ "Indexing CUTG failed."
+ eend
+ fi
+}
+
+src_install() {
+ local file
+ dodoc README CODON_LABEL SPSUM_LABEL
+ if ! use minimal; then
+ dodir /usr/share/${PN}
+ mv *.codon *.spsum "${ED}"/usr/share/${PN} || die \
+ "Installing raw CUTG database failed."
+ fi
+
+ if use emboss; then
+ dodir /usr/share/EMBOSS/data/CODONS
+ cd CODONS || die
+ for file in *; do
+ mv ${file} "${ED}"/usr/share/EMBOSS/data/CODONS/ || die \
+ "Installing the EMBOSS-indexed database failed."
+ done
+ fi
+}
diff --git a/sci-biology/cutg/metadata.xml b/sci-biology/cutg/metadata.xml
new file mode 100644
index 000000000000..59b110912ca6
--- /dev/null
+++ b/sci-biology/cutg/metadata.xml
@@ -0,0 +1,12 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <longdescription>
+ Codon usage tables maintained at the Kazusa DNA Research Institute.
+ Codon usage in individual genes has been calculated using the
+ nucleotide sequence data obtained from the GenBank Genetic Sequence
+ Database. The compilation of codon usage is synchronized with each
+ major release of GenBank.
+ </longdescription>
+</pkgmetadata>
diff --git a/sci-biology/dialign-tx/Manifest b/sci-biology/dialign-tx/Manifest
new file mode 100644
index 000000000000..de90a59afc93
--- /dev/null
+++ b/sci-biology/dialign-tx/Manifest
@@ -0,0 +1 @@
+DIST DIALIGN-TX_1.0.2.tar.gz 1765296 SHA256 fb3940a48a12875332752a298f619f0da62593189cd257d28932463c7cebcb8f SHA512 ff43f1f2900bdd12b7a8ba382a4d6ad68e6c2e6d7ceb1a65f0e571bb891cc2dc2661fb6ce698aaabf0e20c14565b5927ae0076a7170c8611679f936851a00c43 WHIRLPOOL 70565aa507f23a4f79affd8bda64e1b2698680e2288718c7518bd1d3782ca51ab747f8860e5513e7b1d480efd065702cc407c8137e96c47c3aad28ecdd345277
diff --git a/sci-biology/dialign-tx/dialign-tx-1.0.2-r1.ebuild b/sci-biology/dialign-tx/dialign-tx-1.0.2-r1.ebuild
new file mode 100644
index 000000000000..c73d043742b8
--- /dev/null
+++ b/sci-biology/dialign-tx/dialign-tx-1.0.2-r1.ebuild
@@ -0,0 +1,44 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit eutils multilib toolchain-funcs
+
+MY_P=DIALIGN-TX_${PV}
+
+DESCRIPTION="Greedy and progressive approaches for segment-based multiple sequence alignment"
+HOMEPAGE="http://dialign-tx.gobics.de/"
+SRC_URI="http://dialign-tx.gobics.de/${MY_P}.tar.gz"
+
+LICENSE="LGPL-2.1"
+SLOT="0"
+KEYWORDS="amd64 x86"
+IUSE=""
+
+S=${WORKDIR}/${MY_P}
+
+src_prepare() {
+ sed -e "s/\$(CC) -o/\$(CC) \$(LDFLAGS) -o/" \
+ -i source/Makefile || die #336533
+ epatch "${FILESDIR}"/${P}-implicits.patch
+}
+
+src_compile() {
+ emake -C source clean
+ emake -C source CC="$(tc-getCC)" \
+ CPPFLAGS=""
+}
+
+src_install() {
+ dobin "${S}"/source/dialign-tx
+ insinto /usr/$(get_libdir)/${PN}/conf
+ doins "${S}"/conf/*
+}
+
+pkg_postinst() {
+ einfo "The configuration directory is"
+ einfo "${ROOT}usr/$(get_libdir)/${PN}/conf"
+ einfo "You will need to pass this to ${PN} on every run."
+}
diff --git a/sci-biology/dialign-tx/files/dialign-tx-1.0.2-implicits.patch b/sci-biology/dialign-tx/files/dialign-tx-1.0.2-implicits.patch
new file mode 100644
index 000000000000..a8388d03232f
--- /dev/null
+++ b/sci-biology/dialign-tx/files/dialign-tx-1.0.2-implicits.patch
@@ -0,0 +1,18 @@
+--- source/museq.c
++++ source/museq.c
+@@ -38,6 +38,7 @@
+ //extern void calc_weight(struct diag* dg, struct scr_matrix* smatrix,
+ // struct prob_dist *pdist);
+ //extern struct diag_col *create_diag_col(int seq_amount);
++extern void free_diag(struct diag* dg);
+ extern void free_diag_col(struct diag_col* dcol);
+ extern struct diag_col *find_all_diags(struct scr_matrix *smatrix,
+ struct prob_dist *pdist,
+@@ -52,6 +53,7 @@
+
+ // alig.c
+ extern struct alignment* create_empty_alignment(struct seq_col *scol);
++extern void free_alignment(struct alignment *algn);
+ //extern char adapt_diag(struct alignment *algn, struct scr_matrix *smatrix, struct diag* dg);
+ extern int simple_aligner(struct seq_col *scol, struct diag_col *dcol,
+ struct scr_matrix* smatrix,
diff --git a/sci-biology/dialign-tx/metadata.xml b/sci-biology/dialign-tx/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/dialign-tx/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/dialign2/Manifest b/sci-biology/dialign2/Manifest
new file mode 100644
index 000000000000..8f3f4080e56f
--- /dev/null
+++ b/sci-biology/dialign2/Manifest
@@ -0,0 +1 @@
+DIST dialign-2.2.1-src.tar.gz 209015 SHA256 046361bb4ca6e4ab2ac5e634cfcd673f964a887006c09c1b8bd3310fac86f519 SHA512 eb51fbc8d81e384ac19e9cc957be233287a1d81a7f020d77ab16ee6943382bd4e81099c0c9028fcff130def62cdf19de59e9a9c08ea4cb67b9d8f1939eb3bc45 WHIRLPOOL a6c5cd25e8e1f3d3738ae0a7f9eaac2509a17400cc3492b9b0b5991c08df08b586c003bbaa3f92d22ae8dd13a66488e6acbbce0aca798cfd20938cb391a02f84
diff --git a/sci-biology/dialign2/dialign2-2.2.1.ebuild b/sci-biology/dialign2/dialign2-2.2.1.ebuild
new file mode 100644
index 000000000000..58557729b529
--- /dev/null
+++ b/sci-biology/dialign2/dialign2-2.2.1.ebuild
@@ -0,0 +1,35 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+inherit toolchain-funcs
+
+DESCRIPTION="Multiple sequence alignment"
+HOMEPAGE="http://bibiserv.techfak.uni-bielefeld.de/dialign"
+SRC_URI="http://bibiserv.techfak.uni-bielefeld.de/applications/dialign/resources/downloads/dialign-2.2.1-src.tar.gz"
+
+SLOT="0"
+LICENSE="LGPL-2.1"
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux"
+IUSE=""
+
+S="${WORKDIR}"/dialign_package
+
+src_compile() {
+ emake -C src \
+ CC="$(tc-getCC)" \
+ CFLAGS="${CFLAGS} -I. -DCONS -c"
+}
+
+src_install() {
+ dobin src/${PN}-2
+ insinto /usr/share/${PN}
+ doins dialign2_dir/*
+
+ cat >> "${T}"/80${PN} <<- EOF
+ DIALIGN2_DIR="${EPREFIX}/usr/share/${PN}"
+ EOF
+ doenvd "${T}"/80${PN}
+}
diff --git a/sci-biology/dialign2/metadata.xml b/sci-biology/dialign2/metadata.xml
new file mode 100644
index 000000000000..7bc6ee8ea837
--- /dev/null
+++ b/sci-biology/dialign2/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <maintainer>
+ <email>jlec@gentoo.org</email>
+ <name>Justin Lecher</name>
+ </maintainer>
+</pkgmetadata>
diff --git a/sci-biology/diya/Manifest b/sci-biology/diya/Manifest
new file mode 100644
index 000000000000..fe0ae5f610cb
--- /dev/null
+++ b/sci-biology/diya/Manifest
@@ -0,0 +1 @@
+DIST diya-1.0-rc4.tar.gz 386706 SHA256 13f7dd4dd7f96143948587884954e337552d7491347c2c174e786824880590c7
diff --git a/sci-biology/diya/diya-1.0_rc4.ebuild b/sci-biology/diya/diya-1.0_rc4.ebuild
new file mode 100644
index 000000000000..2211525f8af9
--- /dev/null
+++ b/sci-biology/diya/diya-1.0_rc4.ebuild
@@ -0,0 +1,43 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="5"
+
+inherit perl-module
+
+DESCRIPTION="Do It Yourself Annotation, a collection of tools and libraries for sequence assembly and annotation"
+HOMEPAGE="http://gmod.org/wiki/Diya"
+SRC_URI="mirror://sourceforge/diyg/files/diya/diya-1.0/diya-${PV/_/-}.tar.gz"
+
+LICENSE="GPL-3"
+SLOT="0"
+IUSE="-minimal"
+KEYWORDS="~amd64 ~x86"
+
+DEPEND="sci-biology/bioperl
+ dev-perl/Data-Utilities
+ dev-perl/XML-Simple"
+RDEPEND="${DEPEND}
+ !minimal? (
+ sci-biology/mummer
+ sci-biology/glimmer
+ sci-biology/trnascan-se
+ sci-biology/infernal )"
+
+# see ftp://ftp.ncbi.nih.gov/blast/ to check if blast and blast+ are different from ncbi-tools and ncbi-tools++
+# * rfamscan.pl v0.1 (http://www.sanger.ac.uk/Users/sgj/code/)
+# * UniRef50 (http://www.ebi.ac.uk/uniref/)
+# * Protein Clusters (ftp://ftp.ncbi.nih.gov/genomes/Bacteria/CLUSTERS/)
+# The file cddid_all.tbl can be found at ftp://ftp.ncbi.nih.gov/pub/mmdb/cdd/.
+
+S="${WORKDIR}/diya-${PV/_/-}"
+
+SRC_TEST=do
+
+src_install() {
+ mydoc="INSTALL README docs/diya.html"
+ perl-module_src_install
+ insinto /usr/share/${PN}
+ doins -r diya.conf docs examples scripts
+}
diff --git a/sci-biology/diya/metadata.xml b/sci-biology/diya/metadata.xml
new file mode 100644
index 000000000000..d6b9de8b20a7
--- /dev/null
+++ b/sci-biology/diya/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <upstream>
+ <remote-id type="sourceforge">diyg</remote-id>
+ </upstream>
+</pkgmetadata>
diff --git a/sci-biology/elph/Manifest b/sci-biology/elph/Manifest
new file mode 100644
index 000000000000..60015030796d
--- /dev/null
+++ b/sci-biology/elph/Manifest
@@ -0,0 +1,2 @@
+DIST ELPH-0.1.5.tar.gz 153150 RMD160 7e60e2cf9a99cb435768cebbcd1506164e8a901c SHA1 1a3820c851ac0d021c9696ba1fd4eec819d82dbc SHA256 6ffa160f85cb2569bdf869cb0514dc624afcef4f2d8a36efbd1228d1a16cf361
+DIST ELPH-1.0.1.tar.gz 113476 RMD160 854bc34aba30f1c7493536e1b2e36dd8143af7e7 SHA1 9c8bf6ac54ade29daa15dc07aeeb94747626298a SHA256 6d944401d2457d75815a34dbb5780f05df569eb1edfd00909b33c4c4c4ff40b9
diff --git a/sci-biology/elph/elph-0.1.5.ebuild b/sci-biology/elph/elph-0.1.5.ebuild
new file mode 100644
index 000000000000..5fc361ace8fd
--- /dev/null
+++ b/sci-biology/elph/elph-0.1.5.ebuild
@@ -0,0 +1,37 @@
+# Copyright 1999-2008 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Estimated Locations of Pattern Hits - Motif finder program"
+LICENSE="Artistic"
+HOMEPAGE="http://cbcb.umd.edu/software/ELPH/"
+SRC_URI="ftp://ftp.cbcb.umd.edu/pub/software/elph/ELPH-${PV}.tar.gz"
+
+SLOT="0"
+IUSE=""
+KEYWORDS="x86"
+
+S="${WORKDIR}/ELPH/sources"
+
+src_unpack() {
+ unpack ${A}
+ cd "${S}"
+ epatch "${FILESDIR}"/${P}-usage.patch
+ sed -i -e "s/CC := g++/CC := $(tc-getCXX)/" \
+ -e "s/-fno-exceptions -fno-rtti -D_REENTRANT -g/${CXXFLAGS}/" \
+ -e "s/LINKER := g++/LINKER := $(tc-getCXX)/" \
+ Makefile || die "Failed to patch Makefile."
+}
+
+src_compile() {
+ make || die "Compilation failed."
+}
+
+src_install() {
+ dobin elph || die "Failed to install program."
+ cd "${WORKDIR}"/ELPH
+ dodoc VERSION || die "Documentation installation failed."
+ newdoc Readme.ELPH README || die "Readme installation failed."
+}
diff --git a/sci-biology/elph/elph-1.0.1.ebuild b/sci-biology/elph/elph-1.0.1.ebuild
new file mode 100644
index 000000000000..78476added83
--- /dev/null
+++ b/sci-biology/elph/elph-1.0.1.ebuild
@@ -0,0 +1,28 @@
+# Copyright 1999-2010 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+inherit eutils toolchain-funcs
+
+DESCRIPTION="Estimated Locations of Pattern Hits - Motif finder program"
+LICENSE="Artistic"
+HOMEPAGE="http://cbcb.umd.edu/software/ELPH/"
+SRC_URI="ftp://ftp.cbcb.umd.edu/pub/software/elph/ELPH-${PV}.tar.gz"
+
+SLOT="0"
+IUSE=""
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+S=${WORKDIR}/ELPH/sources
+
+src_compile() {
+ emake CC="$(tc-getCXX)" LINKER="$(tc-getCXX)" \
+ CFLAGS="${CXXFLAGS} -D_REENTRANT" LDFLAGS="${LDFLAGS}" || die
+}
+
+src_install() {
+ dobin elph || die "Failed to install program."
+ cd "${WORKDIR}"/ELPH
+ dodoc VERSION || die "Documentation installation failed."
+ newdoc Readme.ELPH README || die "Readme installation failed."
+}
diff --git a/sci-biology/elph/files/elph-0.1.4-usage.patch b/sci-biology/elph/files/elph-0.1.4-usage.patch
new file mode 100644
index 000000000000..be49e2d1ebb8
--- /dev/null
+++ b/sci-biology/elph/files/elph-0.1.4-usage.patch
@@ -0,0 +1,133 @@
+--- elph.cc~ 2003-06-03 14:45:22.000000000 -0400
++++ elph.cc 2004-10-30 10:14:49.220415168 -0400
+@@ -26,11 +26,11 @@
+ period variable\n\
+ -x : print maximum positions within sequences\n\
+ -g : find significance of motif\n\
+- -t <matrix> : test if there is significant difference between the two
+- input files for a given motif matrix; <matrix> is the file
++ -t <matrix> : test if there is significant difference between the two\n\
++ input files for a given motif matrix; <matrix> is the file\n\
+ containing the motif matrix\n\
+- -l : compute Least Likely Consensus (LLC) for given motif
+- -c : in conjunction with -m option: motif is not necessarily in
++ -l : compute Least Likely Consensus (LLC) for given motif\n\
++ -c : in conjunction with -m option: motif is not necessarily in\n\
+ the closest edit distance from input motif\n\
+ LEN=n : n = length of motif\n\
+ ITERNO=n : n = no of iterations to compute the global maximum;\n\
+@@ -41,7 +41,7 @@
+ default = 1000\n\
+ "
+
+-// global variables:
++// global variables:
+ int ITER_NO=10;
+ int MAX_LOOP=500;
+ int printmax=0;
+@@ -66,7 +66,7 @@
+ seqType t;
+
+ GArgs args(argc, argv, "ho:abglvdxt:p:s:m:n:LEN=ITERNO=MAXLOOP=SGFNO=");
+-
++
+ // == Process arguments.
+
+ int e;
+@@ -83,7 +83,7 @@
+
+ if(!testfile.is_empty()) { // if testfile is defined then only compute significance between the two files
+
+- M = new Motif(infile,outf,t,matrixfile,pattern,motiflen,ITER_NO,MAX_LOOP,inlocmax,mdet);
++ M = new Motif(infile,outf,t,matrixfile,pattern,motiflen,ITER_NO,MAX_LOOP,inlocmax,mdet);
+ M->twofilesignif(gdet,testfile,SignifNo,print,pattern);
+
+ }
+@@ -93,11 +93,11 @@
+ // given motif
+
+ M = new Motif(infile,outf,t,pattern);
+- if(defLLC) {
++ if(defLLC) {
+ double llc=M->computeLLC(pattern,print);
+ fprintf(outf,"LLC = %f\n",llc);
+ }
+-
++
+ }
+ else {
+
+@@ -108,7 +108,7 @@
+ }
+
+ double globAlignProb;
+-
++
+ globAlignProb=M->findMotif(ITER_NO,MAX_LOOP,inlocmax,1,mdet);
+
+
+@@ -116,13 +116,13 @@
+ /*info=M->InfoPar(globAlignProb);
+ fprintf(outf,"MAP for motif: %.3f InfoPar=%.3f\n\n",globAlignProb,info);
+ M->printMotif();*/
+-
++
+ // optimizing
+ fprintf(stderr,"Optimizing...\n");
+ globAlignProb=M->optimize(globAlignProb,info,closest);
+ fprintf(outf,"\n\n**********************\n\nMotif after optimizing\n");
+ fprintf(outf,"MAP for motif: %.3f InfoPar=%.3f\n\n",globAlignProb,M->InfoPar(globAlignProb));
+-
++
+ if(runsignif) {
+ M->runforsignif(SignifNo,print,gdet,pattern);
+ }
+@@ -134,17 +134,17 @@
+
+ seqType Process_Options(GArgs* args)
+ {
+-
+- if (args->startNonOpt()) { //parse the non-options arguments
++
++ if (args->startNonOpt()) { //parse the non-options arguments
+ //(usually filenames)
+ infile=args->nextNonOpt();
+ }
+
+- if (infile.is_empty() || args->getOpt('h')!=NULL)
++ if (infile.is_empty() || args->getOpt('h')!=NULL)
+ GError("%s",usage); // the empty test is optional you can ignore it if you accept stdin input
+
+ testfile=args->nextNonOpt();
+-
++
+ GString outfile=args->getOpt('o');
+ if (!outfile.is_empty()) {
+ outf=fopen(outfile, "w");
+@@ -156,7 +156,7 @@
+ matrixfile=args->getOpt('t');
+
+ GString param;
+-
++
+ pattern=args->getOpt('m');
+ if(pattern.is_empty()) {
+ param=args->getOpt("LEN");
+@@ -200,7 +200,7 @@
+
+ seqType t;
+ if(args->getOpt('a')!=NULL) t=aac; else t=nucl;
+-
++
+ return(t);
+
+ }
+@@ -210,7 +210,7 @@
+ Motif *M;
+
+ double llcmax=-HUGE_VAL;
+- GString seed;
++ GString seed;
+ for(int i1=0;i1<4;i1++)
+ for(int i2=0;i2<4;i2++)
+ for(int i3=0;i3<4;i3++)
diff --git a/sci-biology/elph/files/elph-0.1.5-usage.patch b/sci-biology/elph/files/elph-0.1.5-usage.patch
new file mode 100644
index 000000000000..139b83c1c1c6
--- /dev/null
+++ b/sci-biology/elph/files/elph-0.1.5-usage.patch
@@ -0,0 +1,133 @@
+--- elph.cc.old 2005-01-11 14:17:47.000000000 -0500
++++ elph.cc 2005-01-27 19:42:30.218350552 -0500
+@@ -26,11 +26,11 @@
+ period variable\n\
+ -x : print maximum positions within sequences\n\
+ -g : find significance of motif\n\
+- -t <matrix> : test if there is significant difference between the two
+- input files for a given motif matrix; <matrix> is the file
++ -t <matrix> : test if there is significant difference between the two\n\
++ input files for a given motif matrix; <matrix> is the file\n\
+ containing the motif matrix\n\
+- -l : compute Least Likely Consensus (LLC) for given motif
+- -c : in conjunction with -m option: motif is not necessarily in
++ -l : compute Least Likely Consensus (LLC) for given motif\n\
++ -c : in conjunction with -m option: motif is not necessarily in\n\
+ the closest edit distance from input motif\n\
+ LEN=n : n = length of motif\n\
+ ITERNO=n : n = no of iterations to compute the global maximum;\n\
+@@ -41,7 +41,7 @@
+ default = 1000\n\
+ "
+
+-// global variables:
++// global variables:
+ int ITER_NO=10;
+ int MAX_LOOP=500;
+ int printmax=0;
+@@ -66,7 +66,7 @@
+ seqType t;
+
+ GArgs args(argc, argv, "ho:abcglvdxt:p:s:m:n:LEN=ITERNO=MAXLOOP=SGFNO=");
+-
++
+ // == Process arguments.
+
+ int e;
+@@ -83,7 +83,7 @@
+
+ if(!testfile.is_empty()) { // if testfile is defined then only compute significance between the two files
+
+- M = new Motif(infile,outf,t,matrixfile,pattern,motiflen,ITER_NO,MAX_LOOP,inlocmax,mdet);
++ M = new Motif(infile,outf,t,matrixfile,pattern,motiflen,ITER_NO,MAX_LOOP,inlocmax,mdet);
+ M->twofilesignif(gdet,testfile,SignifNo,print,pattern);
+
+ }
+@@ -93,11 +93,11 @@
+ // given motif
+
+ M = new Motif(infile,outf,t,pattern);
+- if(defLLC) {
++ if(defLLC) {
+ double llc=M->computeLLC(pattern,print);
+ fprintf(outf,"LLC = %f\n",llc);
+ }
+-
++
+ }
+ else {
+
+@@ -108,7 +108,7 @@
+ }
+
+ double globAlignProb;
+-
++
+ globAlignProb=M->findMotif(ITER_NO,MAX_LOOP,inlocmax,1,mdet);
+
+
+@@ -116,13 +116,13 @@
+ /*info=M->InfoPar(globAlignProb);
+ fprintf(outf,"MAP for motif: %.3f InfoPar=%.3f\n\n",globAlignProb,info);
+ M->printMotif();*/
+-
++
+ // optimizing
+ fprintf(stderr,"Optimizing...\n");
+ globAlignProb=M->optimize(globAlignProb,info,closest);
+ fprintf(outf,"\n\n**********************\n\nMotif after optimizing\n");
+ fprintf(outf,"MAP for motif: %.3f InfoPar=%.3f\n\n",globAlignProb,M->InfoPar(globAlignProb));
+-
++
+ if(runsignif) {
+ M->runforsignif(SignifNo,print,gdet,pattern);
+ }
+@@ -134,17 +134,17 @@
+
+ seqType Process_Options(GArgs* args)
+ {
+-
+- if (args->startNonOpt()) { //parse the non-options arguments
++
++ if (args->startNonOpt()) { //parse the non-options arguments
+ //(usually filenames)
+ infile=args->nextNonOpt();
+ }
+
+- if (infile.is_empty() || args->getOpt('h')!=NULL)
++ if (infile.is_empty() || args->getOpt('h')!=NULL)
+ GError("%s",usage); // the empty test is optional you can ignore it if you accept stdin input
+
+ testfile=args->nextNonOpt();
+-
++
+ GString outfile=args->getOpt('o');
+ if (!outfile.is_empty()) {
+ outf=fopen(outfile, "w");
+@@ -156,7 +156,7 @@
+ matrixfile=args->getOpt('t');
+
+ GString param;
+-
++
+ pattern=args->getOpt('m');
+ if(pattern.is_empty()) {
+ param=args->getOpt("LEN");
+@@ -200,7 +200,7 @@
+
+ seqType t;
+ if(args->getOpt('a')!=NULL) t=aac; else t=nucl;
+-
++
+ return(t);
+
+ }
+@@ -210,7 +210,7 @@
+ Motif *M;
+
+ double llcmax=-HUGE_VAL;
+- GString seed;
++ GString seed;
+ for(int i1=0;i1<4;i1++)
+ for(int i2=0;i2<4;i2++)
+ for(int i3=0;i3<4;i3++)
diff --git a/sci-biology/elph/metadata.xml b/sci-biology/elph/metadata.xml
new file mode 100644
index 000000000000..469879ba8f5b
--- /dev/null
+++ b/sci-biology/elph/metadata.xml
@@ -0,0 +1,12 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+ <longdescription>
+ ELPH is a general-purpose Gibbs sampler for finding motifs in a set of
+ DNA or protein sequences. The program takes as input a set containing
+ anywhere from a few dozen to thousands of sequences, and searches
+ through them for the most common motif, assuming that each sequence
+ contains one copy of the motif.
+ </longdescription>
+</pkgmetadata>
diff --git a/sci-biology/embassy-cbstools/Manifest b/sci-biology/embassy-cbstools/Manifest
new file mode 100644
index 000000000000..408037d6a1ec
--- /dev/null
+++ b/sci-biology/embassy-cbstools/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-cbstools-1.0.0.tar.gz 343812 SHA256 b61b6c19d18dd3a35eef248feb92ee68bcee0e9fc99af5185deee04a17fa3693
+DIST embassy-cbstools-1.0.0.650.tar.gz 452594 SHA256 adb97baa5c7c44c1451537c8cb608024322435d5a4a2693a063a501e42f7127c SHA512 8f16f726220a36f998d8a0f1d8aec9ec6b2db8160b15bed7bafc5a65d57a937bd91ee831ecabe2e9aaa8cecaa18d050f16439a276a882730fde3fa4937bec384 WHIRLPOOL 82813e295f5576d30d474eb9294c2c2c75c577abb59f57baae35cc8cceaccd5a9216f50be43d61523feea80ad6212c955a084bcd9f84da9b5802d050cdc4092a
diff --git a/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.650.ebuild b/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.650.ebuild
new file mode 100644
index 000000000000..b2f9738aa495
--- /dev/null
+++ b/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Applications from the CBS group"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.ebuild b/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.ebuild
new file mode 100644
index 000000000000..ca1539905c99
--- /dev/null
+++ b/sci-biology/embassy-cbstools/embassy-cbstools-1.0.0.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS wrappers for applications from the CBS group"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-cbstools/files/embassy-cbstools-1.0.0.650_fix-build-system.patch b/sci-biology/embassy-cbstools/files/embassy-cbstools-1.0.0.650_fix-build-system.patch
new file mode 100644
index 000000000000..d29310efcb47
--- /dev/null
+++ b/sci-biology/embassy-cbstools/files/embassy-cbstools-1.0.0.650_fix-build-system.patch
@@ -0,0 +1,110 @@
+ configure.ac | 49 +++++++------------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 6 ++----
+ 3 files changed, 10 insertions(+), 47 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index a70d4d2..b8f5e79 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 824a03c..9db171d 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -19,9 +19,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -65,5 +63,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-cbstools/metadata.xml b/sci-biology/embassy-cbstools/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-cbstools/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-clustalomega/Manifest b/sci-biology/embassy-clustalomega/Manifest
new file mode 100644
index 000000000000..43c85d868e12
--- /dev/null
+++ b/sci-biology/embassy-clustalomega/Manifest
@@ -0,0 +1 @@
+DIST embassy-clustalomega-1.1.0.tar.gz 618177 SHA256 98bcb7e561a6f0373ddf96c5d98c0f043da1cddb75dc94a1dca439c54b5a27b5 SHA512 fc16f9505e0300ae184e292fb1d96ce6b90eaf80298f847769466a84726d10ea58e3f4c14ed21a9e2c36d7fa533c7ad248b4995bf41c8abbd0fed1faf1fd4801 WHIRLPOOL f06e66144845b85cdc253571f126bdc9074d3efaad45c92c83bfc8abfc8a0a70b75435e2917f76519a53e94f8649805e99c88137bd04e59cc5c15dc6dabc6b54
diff --git a/sci-biology/embassy-clustalomega/embassy-clustalomega-1.1.0.ebuild b/sci-biology/embassy-clustalomega/embassy-clustalomega-1.1.0.ebuild
new file mode 100644
index 000000000000..620383da2eb0
--- /dev/null
+++ b/sci-biology/embassy-clustalomega/embassy-clustalomega-1.1.0.ebuild
@@ -0,0 +1,17 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Clustal Omega - Scalable multiple protein sequences alignment"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~x86 ~x86-linux ~ppc-macos"
+
+RDEPEND+=" sci-biology/clustal-omega"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-clustalomega/files/embassy-clustalomega-1.1.0_fix-build-system.patch b/sci-biology/embassy-clustalomega/files/embassy-clustalomega-1.1.0_fix-build-system.patch
new file mode 100644
index 000000000000..5525d79b525f
--- /dev/null
+++ b/sci-biology/embassy-clustalomega/files/embassy-clustalomega-1.1.0_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index f12ed19..b143922 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 9135679..c201149 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -62,5 +60,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-clustalomega/metadata.xml b/sci-biology/embassy-clustalomega/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-clustalomega/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-domainatrix/Manifest b/sci-biology/embassy-domainatrix/Manifest
new file mode 100644
index 000000000000..74ca98eecf1d
--- /dev/null
+++ b/sci-biology/embassy-domainatrix/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-domainatrix-0.1.0.tar.gz 420983 SHA256 7596e76b79f19d77e27b8ea8a75a3e1ba4c806aa548cb9675f23e2bb434a42b1
+DIST embassy-domainatrix-0.1.650.tar.gz 474066 SHA256 122cae02e529385eb98d51caa3a21b613545b5dbc763e17524afeab1f7d1cb18 SHA512 151e026445abb171a9141ae5576442307121646c66dc811320a6f73be1103203bf04d37b813e5c95ef0873be261cd474835f4dffd042f33f99d7dd4fda19be7b WHIRLPOOL 82689cbedec77da2c7eb62a78e4407e2153d9dc6e4c51608705bc4bfed3556516ca61619982a3fcb02cdf8e37eee68f87aeba9fec23d054b660dad15d81553c0
diff --git a/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.0-r3.ebuild b/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.0-r3.ebuild
new file mode 100644
index 000000000000..ee009ca052f0
--- /dev/null
+++ b/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.0-r3.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Protein domain analysis add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.650.ebuild b/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.650.ebuild
new file mode 100644
index 000000000000..9734758ee2ad
--- /dev/null
+++ b/sci-biology/embassy-domainatrix/embassy-domainatrix-0.1.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Protein domain analysis add-on package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-domainatrix/files/embassy-domainatrix-0.1.650_fix-build-system.patch b/sci-biology/embassy-domainatrix/files/embassy-domainatrix-0.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..a932e1ebe21e
--- /dev/null
+++ b/sci-biology/embassy-domainatrix/files/embassy-domainatrix-0.1.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index d16cc02..d327a0d 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index d405d00..54be7ca 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -64,5 +62,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-domainatrix/metadata.xml b/sci-biology/embassy-domainatrix/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-domainatrix/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-domalign/Manifest b/sci-biology/embassy-domalign/Manifest
new file mode 100644
index 000000000000..87fdc97be669
--- /dev/null
+++ b/sci-biology/embassy-domalign/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-domalign-0.1.0.tar.gz 462156 SHA256 c448dc461b36e299c6338f25c102de2388cc33515eae8fd1dc7097920efa409a
+DIST embassy-domalign-0.1.650.tar.gz 498669 SHA256 df64428f965f3bf7636b649d60fbfc68450b6ff6981d1b971840b55ac7996509 SHA512 14e86664e9038acc60fbec92fa218e218921fb1e51cc2e482fb1760ccd9ea16041dc8a2a9f5f320fca3340b7efdc48ea9d753b048a43966fc3431acdaddc7846 WHIRLPOOL c7de34abbfaf407e3c4d5dc3582ad9a45adc4c7c91a7376e5cedaaa620711ffb315d647fbd813315d93edbbfed38b130ace7a5b3d016f638af64d02432c6db37
diff --git a/sci-biology/embassy-domalign/embassy-domalign-0.1.0-r3.ebuild b/sci-biology/embassy-domalign/embassy-domalign-0.1.0-r3.ebuild
new file mode 100644
index 000000000000..8a0e7bb2de92
--- /dev/null
+++ b/sci-biology/embassy-domalign/embassy-domalign-0.1.0-r3.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Protein domain alignment add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-domalign/embassy-domalign-0.1.650.ebuild b/sci-biology/embassy-domalign/embassy-domalign-0.1.650.ebuild
new file mode 100644
index 000000000000..b26dd2cb35df
--- /dev/null
+++ b/sci-biology/embassy-domalign/embassy-domalign-0.1.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Protein domain alignment add-on package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-domalign/files/embassy-domalign-0.1.650_fix-build-system.patch b/sci-biology/embassy-domalign/files/embassy-domalign-0.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..033ddf7b6535
--- /dev/null
+++ b/sci-biology/embassy-domalign/files/embassy-domalign-0.1.650_fix-build-system.patch
@@ -0,0 +1,101 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 7 ++-----
+ 2 files changed, 9 insertions(+), 47 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 693eb4d..dc0fda9 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 8785446..fe85f11 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,10 +17,7 @@ AM_CPPFLAGS = -I../include -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I../include -I${embprefix}/include \
+- -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -63,5 +60,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ ../../../plplot/libeplplot.la $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-domalign/metadata.xml b/sci-biology/embassy-domalign/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-domalign/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-domsearch/Manifest b/sci-biology/embassy-domsearch/Manifest
new file mode 100644
index 000000000000..76709b452174
--- /dev/null
+++ b/sci-biology/embassy-domsearch/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-domsearch-0.1.0.tar.gz 470537 SHA256 fb34c1b2f668f89abe6912fe75e9828c53802820753aa8a1b952f37894939c95
+DIST embassy-domsearch-0.1.650.tar.gz 504183 SHA256 43c1d99723f42d0f79c4e9d11abaff084bed8262ec958f237a51465cd7afa168 SHA512 a242100dc7b4b1f4a838dbf65dffb0475b6b890c7d68efae6a74beb3d4784d031f92365a50a41c0d7ea7d1b4be5e65a298626a798970c74df0d5f85427a51589 WHIRLPOOL 02afa5cdf4d82b127317537c088b91592f6c4624769b7b13f030fd59590b533fb8ec62189b165bbf885d967069883f5e08f562e7187294468700ce9571a47111
diff --git a/sci-biology/embassy-domsearch/embassy-domsearch-0.1.0-r3.ebuild b/sci-biology/embassy-domsearch/embassy-domsearch-0.1.0-r3.ebuild
new file mode 100644
index 000000000000..48f945c08d8a
--- /dev/null
+++ b/sci-biology/embassy-domsearch/embassy-domsearch-0.1.0-r3.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Protein domain search add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-domsearch/embassy-domsearch-0.1.650.ebuild b/sci-biology/embassy-domsearch/embassy-domsearch-0.1.650.ebuild
new file mode 100644
index 000000000000..e9c4a6c48fd4
--- /dev/null
+++ b/sci-biology/embassy-domsearch/embassy-domsearch-0.1.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Protein domain search add-on package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-domsearch/files/embassy-domsearch-0.1.650_fix-build-system.patch b/sci-biology/embassy-domsearch/files/embassy-domsearch-0.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..d24857c8386d
--- /dev/null
+++ b/sci-biology/embassy-domsearch/files/embassy-domsearch-0.1.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index f0f97fa..d419d7d 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 9829ebd..433a5c5 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -62,5 +60,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ ../../../plplot/libeplplot.la $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-domsearch/metadata.xml b/sci-biology/embassy-domsearch/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-domsearch/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-emnu/Manifest b/sci-biology/embassy-emnu/Manifest
new file mode 100644
index 000000000000..7c67122bbc0a
--- /dev/null
+++ b/sci-biology/embassy-emnu/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-emnu-1.05.tar.gz 390229 SHA256 2f58621cc7151f813ce608dcd5b3505fc84af882c778fe28167508d6851dc333
+DIST embassy-emnu-1.05.650.tar.gz 425595 SHA256 0a5ae3a1fbaf7952ba5e28cf89bf9cbf521cea9fe4703170b532c50542c8ea0e SHA512 0cb0dafd53c4fd410409430dc12353989d2c226191acace26e81b457602b6b6c60f8eb1d0d9b36ea90b2420010c1a3e887a2458e8487008a36775961e378d0dd WHIRLPOOL ab62608ab9a1f433a0781c672c80daf6447f81e98159adc506e4a6fd22c7c6376fd6b5ae14f91aba5bdad76f66c3e0a9a89638cf2288f90aa70c36402c41cc6a
diff --git a/sci-biology/embassy-emnu/embassy-emnu-1.05-r5.ebuild b/sci-biology/embassy-emnu/embassy-emnu-1.05-r5.ebuild
new file mode 100644
index 000000000000..3163cb635c4c
--- /dev/null
+++ b/sci-biology/embassy-emnu/embassy-emnu-1.05-r5.ebuild
@@ -0,0 +1,19 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS Menu is Not UNIX - Simple menu of EMBOSS applications"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
+
+RDEPEND="sys-libs/ncurses
+ ${RDEPEND}"
+
+DEPEND="sys-libs/ncurses
+ ${DEPEND}"
diff --git a/sci-biology/embassy-emnu/embassy-emnu-1.05.650.ebuild b/sci-biology/embassy-emnu/embassy-emnu-1.05.650.ebuild
new file mode 100644
index 000000000000..ee617cddf7ca
--- /dev/null
+++ b/sci-biology/embassy-emnu/embassy-emnu-1.05.650.ebuild
@@ -0,0 +1,19 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Simple menu of EMBOSS applications"
+EBO_EXTRA_ECONF="$(use_enable ncurses curses)"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+IUSE+=" ncurses"
+
+RDEPEND+=" ncurses? ( sys-libs/ncurses )"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-emnu/files/embassy-emnu-1.05.650_fix-build-system.patch b/sci-biology/embassy-emnu/files/embassy-emnu-1.05.650_fix-build-system.patch
new file mode 100644
index 000000000000..4e14bac1704a
--- /dev/null
+++ b/sci-biology/embassy-emnu/files/embassy-emnu-1.05.650_fix-build-system.patch
@@ -0,0 +1,139 @@
+ configure.ac | 67 +++++++++++---------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 7 +++---
+ 3 files changed, 18 insertions(+), 58 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 7482ade..b815bdb 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+@@ -899,20 +864,16 @@ dnl fi
+
+
+ dnl emnu and mse only: uses curses
+-dnl Test if --with-curses is given
+-AC_ARG_WITH([curses],
+-[AS_HELP_STRING([--with-curses], [curses (or ncurses)])])
++dnl Test if --enable-curses is given
++AC_ARG_ENABLE([curses],
++[AS_HELP_STRING([--enable-curses], [curses])])
+
+-AC_MSG_CHECKING([for curses])
+-
+-AS_IF([test "${with_curses}"],
+-[
+- CPPFLAGS="$CPPFLAGS -I${with_curses}/include -I${with_curses}/include/ncurses"
+- LDFLAGS="$LDFLAGS -L${with_curses}/lib"
++AS_IF([test "x$enable_curses" = "xyes"], [
++ PKG_CHECK_MODULES([NCURSES], [ncurses])
++ PKG_CHECK_MODULES([FORM], [form])
++ PKG_CHECK_MODULES([MENU], [menu])
+ ])
+
+-AC_CHECK_LIB([ncurses], [main], [LIBS="$LIBS -lncurses"], [LIBS="$LIBS -lcurses"])
+-
+
+
+
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index b295079..330c76f 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,8 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS) \
++ $(NCURSES_CFLAGS) $(FORM_CFLAGS) $(MENU_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -57,5 +56,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ ../../../plplot/libeplplot.la -lmenu -lform $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot -lmenu -lform $(XLIB)
++ -lajax $(NLADD) $(NCURSES_LIBS) $(FORM_LIBS) $(MENU_LIBS) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-emnu/metadata.xml b/sci-biology/embassy-emnu/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-emnu/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-esim4/Manifest b/sci-biology/embassy-esim4/Manifest
new file mode 100644
index 000000000000..ade72c4415f8
--- /dev/null
+++ b/sci-biology/embassy-esim4/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-esim4-1.0.0.tar.gz 431898 SHA256 219b3541e2a67d31fd62140c2c9c2b41e2d3d814dec6aaf691f764e337917577
+DIST embassy-esim4-1.0.0.650.tar.gz 473261 SHA256 ce2f8a4e802da7e11ac3cbaf24406d9b33d4aa488f1c68bbbc8e969ec7e0b671 SHA512 623b241915217ffb314e3fc4ca6aed5e1683b78b6c76f899b67c4e5d48ce83c9920d79b1c5a1508d61856c332e614020d0804b7252c535d9622f9623f29cd152 WHIRLPOOL ea34bd05cc41f8e1e4af8eebfca9f1c0888c96f0dbb11df79c2cd8966b27d72f019c8ec3043ca7c9e276e015232476165a77336590ace448766a45163f654d62
diff --git a/sci-biology/embassy-esim4/embassy-esim4-1.0.0-r5.ebuild b/sci-biology/embassy-esim4/embassy-esim4-1.0.0-r5.ebuild
new file mode 100644
index 000000000000..927f8ab6a202
--- /dev/null
+++ b/sci-biology/embassy-esim4/embassy-esim4-1.0.0-r5.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS integrated version of sim4 - Alignment of cDNA and genomic DNA"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-esim4/embassy-esim4-1.0.0.650.ebuild b/sci-biology/embassy-esim4/embassy-esim4-1.0.0.650.ebuild
new file mode 100644
index 000000000000..470cb0b299cd
--- /dev/null
+++ b/sci-biology/embassy-esim4/embassy-esim4-1.0.0.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="sim4 - Alignment of cDNA and genomic DNA"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-esim4/files/embassy-esim4-1.0.0.650_fix-build-system.patch b/sci-biology/embassy-esim4/files/embassy-esim4-1.0.0.650_fix-build-system.patch
new file mode 100644
index 000000000000..ead54c91b5f3
--- /dev/null
+++ b/sci-biology/embassy-esim4/files/embassy-esim4-1.0.0.650_fix-build-system.patch
@@ -0,0 +1,110 @@
+ configure.ac | 49 +++++++------------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 6 ++----
+ 3 files changed, 10 insertions(+), 47 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 924220a..2c45f46 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 0620938..0304bb8 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -63,5 +61,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-esim4/metadata.xml b/sci-biology/embassy-esim4/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-esim4/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-hmmer/Manifest b/sci-biology/embassy-hmmer/Manifest
new file mode 100644
index 000000000000..1aeb5559decf
--- /dev/null
+++ b/sci-biology/embassy-hmmer/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-hmmer-2.3.2.tar.gz 565686 SHA256 9b27f2b7a9059b017e3bd3d31de08f6fbf7d49c3e025d73abd83ff0567732258
+DIST embassy-hmmer-2.3.2.650.tar.gz 587775 SHA256 1464ff5e87c7c429f2fc78ac3554f8bd32cdaf49b8bed095fce6268b9afd4f6a SHA512 eb2c037fec70f4113b9ab59cc4eca9a608e8d0971a7bcc4612d60b1e28556444dd3ecdea4ff7b8f8b34711ad9f655334857e7510e89060459c81994a3abcc02a WHIRLPOOL 59027e96d3e629eb771fa966be95cd30138d6b97223056c95c1cc19d21ec0ffe555ff12f2cadc372ea303a0e06a9c1e673c4e32b2a50d8fd2ab2071d2c04cb83
diff --git a/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2-r2.ebuild b/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2-r2.ebuild
new file mode 100644
index 000000000000..a246730c4b22
--- /dev/null
+++ b/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2-r2.ebuild
@@ -0,0 +1,21 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS wrappers for HMMER - Biological sequence analysis with profile HMMs"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
+
+RDEPEND="~sci-biology/hmmer-2.3.2"
+
+src_install() {
+ embassy_src_install
+ insinto /usr/include/emboss/hmmer
+ doins src/*.h
+}
diff --git a/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2.650.ebuild b/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2.650.ebuild
new file mode 100644
index 000000000000..871d512a172a
--- /dev/null
+++ b/sci-biology/embassy-hmmer/embassy-hmmer-2.3.2.650.ebuild
@@ -0,0 +1,17 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Wrappers for HMMER - Biological sequence analysis with profile HMMs"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+RDEPEND+="sci-biology/hmmer"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-hmmer/files/embassy-hmmer-2.3.2.650_fix-build-system.patch b/sci-biology/embassy-hmmer/files/embassy-hmmer-2.3.2.650_fix-build-system.patch
new file mode 100644
index 000000000000..90c45632eada
--- /dev/null
+++ b/sci-biology/embassy-hmmer/files/embassy-hmmer-2.3.2.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 037ca00..f539ab6 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index dc789bc..5a8c38e 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -67,5 +65,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-hmmer/metadata.xml b/sci-biology/embassy-hmmer/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-hmmer/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-iprscan/Manifest b/sci-biology/embassy-iprscan/Manifest
new file mode 100644
index 000000000000..6d689c8ee615
--- /dev/null
+++ b/sci-biology/embassy-iprscan/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-iprscan-4.3.1.tar.gz 339939 SHA256 df0bdd33ea6f279ed018f4a22e686cc14ff0e9f65342177b3b9dbb2951c3636a
+DIST embassy-iprscan-4.3.1.650.tar.gz 406720 SHA256 9534de155a4efd765a588f567b9b502052360719278e492b1c0dd9e50aa78013 SHA512 eed75693557f141331dfb6bec6961a8f6eab93780cad3b629d547b8635be2df6ec85e5ae0e9646d174a562a0f6d31c3c487a4dacac9efdd393a7144cd5716878 WHIRLPOOL 25b3ac80d0f5e7bb3e4ffe21fcd2657894f23ca4f7e182d527d97b5b869e11206e2ab4f265fca027e419ef7fdd2752b3d11c8ef9518edb72b93dddff4d7dcfc8
diff --git a/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.650.ebuild b/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.650.ebuild
new file mode 100644
index 000000000000..f8e7380c017c
--- /dev/null
+++ b/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="InterProScan motif detection add-on package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.ebuild b/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.ebuild
new file mode 100644
index 000000000000..2ed141470a13
--- /dev/null
+++ b/sci-biology/embassy-iprscan/embassy-iprscan-4.3.1.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="InterProScan motif detection add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-iprscan/files/embassy-iprscan-4.3.1.650_fix-build-system.patch b/sci-biology/embassy-iprscan/files/embassy-iprscan-4.3.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..8c8a1060e30f
--- /dev/null
+++ b/sci-biology/embassy-iprscan/files/embassy-iprscan-4.3.1.650_fix-build-system.patch
@@ -0,0 +1,110 @@
+ configure.ac | 49 +++++++------------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 6 ++----
+ 3 files changed, 10 insertions(+), 47 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 9052ca5..c12c268 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 0afc96a..904b41a 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -58,5 +56,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-iprscan/metadata.xml b/sci-biology/embassy-iprscan/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-iprscan/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-meme/Manifest b/sci-biology/embassy-meme/Manifest
new file mode 100644
index 000000000000..13e38d3a79dd
--- /dev/null
+++ b/sci-biology/embassy-meme/Manifest
@@ -0,0 +1 @@
+DIST embassy-meme-4.7.650.tar.gz 622448 SHA256 a9ce0af5f8e05d82cf7678c9781041520bb9889a5706e38480940003ef2a9e8f SHA512 0536531b198aac09a9fe6c17cf1c60c766789c94a7f83f743a90aaa65061c95534bf398c53611a34549b7ec1a4928fdc45fe0d2553f25f85eeda41f90c2e8c6f WHIRLPOOL 041fec3789c86375edb64b34a0190484cda6a59aab564c5deee19930a8cec0455ed9689d726cb647cca30e7c3c59f728aff5546ab8ad491aed4f331e76497b51
diff --git a/sci-biology/embassy-meme/embassy-meme-4.7.650.ebuild b/sci-biology/embassy-meme/embassy-meme-4.7.650.ebuild
new file mode 100644
index 000000000000..bdbc70a3bab2
--- /dev/null
+++ b/sci-biology/embassy-meme/embassy-meme-4.7.650.ebuild
@@ -0,0 +1,17 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Wrappers for MEME - Multiple Em for Motif Elicitation"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+RDEPEND+=" sci-biology/meme"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-meme/files/embassy-meme-4.7.650_fix-build-system.patch b/sci-biology/embassy-meme/files/embassy-meme-4.7.650_fix-build-system.patch
new file mode 100644
index 000000000000..56f5814e1efa
--- /dev/null
+++ b/sci-biology/embassy-meme/files/embassy-meme-4.7.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 391989f..d921f25 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 1600399..9f28162 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -60,5 +58,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-meme/metadata.xml b/sci-biology/embassy-meme/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-meme/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-memenew/Manifest b/sci-biology/embassy-memenew/Manifest
new file mode 100644
index 000000000000..f42b89771c56
--- /dev/null
+++ b/sci-biology/embassy-memenew/Manifest
@@ -0,0 +1,2 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-memenew-0.1.0.tar.gz 450102 SHA256 5411d1445feb1b5e460e598a9d7e670a4357fe7aa350d96531b1aa9c79fab636
diff --git a/sci-biology/embassy-memenew/embassy-memenew-0.1.0-r1.ebuild b/sci-biology/embassy-memenew/embassy-memenew-0.1.0-r1.ebuild
new file mode 100644
index 000000000000..58f3852fce08
--- /dev/null
+++ b/sci-biology/embassy-memenew/embassy-memenew-0.1.0-r1.ebuild
@@ -0,0 +1,19 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS wrappers for MEME - Multiple Em for Motif Elicitation"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
+
+src_install() {
+ embassy_src_install
+ insinto /usr/include/emboss/meme
+ doins src/INCLUDE/*.h
+}
diff --git a/sci-biology/embassy-memenew/metadata.xml b/sci-biology/embassy-memenew/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-memenew/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-mira/Manifest b/sci-biology/embassy-mira/Manifest
new file mode 100644
index 000000000000..6229623c3b0e
--- /dev/null
+++ b/sci-biology/embassy-mira/Manifest
@@ -0,0 +1,2 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-mira-2.8.2.tar.gz 365566 SHA256 33d756bd50fe26c04aff862f34230feaad831cbe538096e4d8e5c8e0b6784fe1
diff --git a/sci-biology/embassy-mira/embassy-mira-2.8.2.ebuild b/sci-biology/embassy-mira/embassy-mira-2.8.2.ebuild
new file mode 100644
index 000000000000..28e3d2587d1e
--- /dev/null
+++ b/sci-biology/embassy-mira/embassy-mira-2.8.2.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Fragment assembly add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-mira/metadata.xml b/sci-biology/embassy-mira/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-mira/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-mse/Manifest b/sci-biology/embassy-mse/Manifest
new file mode 100644
index 000000000000..15e2c00a0f43
--- /dev/null
+++ b/sci-biology/embassy-mse/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-mse-1.0.0.tar.gz 445562 SHA256 9e3688ff3514b7ea6cf104fbd2a2e611fe726fb7ac4bebab6f3c103f05c08d90
+DIST embassy-mse-3.0.0.650.tar.gz 491747 SHA256 2744c2a447cc16d7ad4d9049c61793fc2803659b83b0666b3ca9c30648dac88c SHA512 4ae34de71566464e4352ff7b3bbd19b8bf0571013f34253495cf5cc57240bac9c75192c302eb0231763db1745a7e3e79ebcdcb006e36ea4621a886b213eb96d3 WHIRLPOOL 8d257e79161d5989ac2fe3fe5e55e073402b57795121693fd43ac0d2d348032abb7927d4e40faf2b4db182145f9bcdcc7ba5d7b0534df10dd844c256b8dacb9b
diff --git a/sci-biology/embassy-mse/embassy-mse-1.0.0-r6.ebuild b/sci-biology/embassy-mse/embassy-mse-1.0.0-r6.ebuild
new file mode 100644
index 000000000000..8767aee8f8d3
--- /dev/null
+++ b/sci-biology/embassy-mse/embassy-mse-1.0.0-r6.ebuild
@@ -0,0 +1,19 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS integrated version of MSE - Multiple Sequence Screen Editor"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
+
+src_install() {
+ embassy_src_install
+ insinto /usr/include/emboss/mse
+ doins h/*.h
+}
diff --git a/sci-biology/embassy-mse/embassy-mse-3.0.0.650.ebuild b/sci-biology/embassy-mse/embassy-mse-3.0.0.650.ebuild
new file mode 100644
index 000000000000..32b6410620e1
--- /dev/null
+++ b/sci-biology/embassy-mse/embassy-mse-3.0.0.650.ebuild
@@ -0,0 +1,25 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="MSE - Multiple Sequence Screen Editor"
+EBO_EXTRA_ECONF="$(use_enable ncurses curses)"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+IUSE+=" ncurses"
+
+RDEPEND+=" ncurses? ( sys-libs/ncurses )"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
+
+src_install() {
+ autotools-utils_src_install
+ insinto /usr/include/emboss/mse
+ doins h/*.h
+}
diff --git a/sci-biology/embassy-mse/files/embassy-mse-3.0.0.650_fix-build-system.patch b/sci-biology/embassy-mse/files/embassy-mse-3.0.0.650_fix-build-system.patch
new file mode 100644
index 000000000000..c1095b266d60
--- /dev/null
+++ b/sci-biology/embassy-mse/files/embassy-mse-3.0.0.650_fix-build-system.patch
@@ -0,0 +1,149 @@
+ ckit/Makefile.am | 2 +-
+ configure.ac | 67 +++++++++++---------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 6 ++---
+ 4 files changed, 18 insertions(+), 59 deletions(-)
+
+diff --git a/ckit/Makefile.am b/ckit/Makefile.am
+index f87b131..a670d2b 100644
+--- a/ckit/Makefile.am
++++ b/ckit/Makefile.am
+@@ -2,7 +2,7 @@
+
+ lib_LTLIBRARIES = libckit.la
+
+-AM_CPPFLAGS = -I../h
++AM_CPPFLAGS = -I$(top_srcdir)/h
+
+ CKITSRC = datafiles.c next.c seqentry.c strings.c gcg.c pir.c \
+ seqspec.c ttyinterface.c nextseqentry.c \
+diff --git a/configure.ac b/configure.ac
+index a20d488..eb208bf 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+@@ -1000,17 +965,13 @@ AS_IF([test "x${enable_savestats}" = "xyes"],
+
+
+
+-dnl emnu and mse only: uses curses
+-dnl Test if --with-curses is given
+-AC_ARG_WITH([curses],
+- [AS_HELP_STRING([--with-curses],
+- [curses (or ncurses)])])
+-if test "${with_curses}" ; then
+-AC_MSG_CHECKING([for curses])
+-CPPFLAGS="$CPPFLAGS -I${with_curses}/include -I${with_curses}/include/ncurses"
+-LDFLAGS="$LDFLAGS -L${with_curses}/lib"
+-fi
+-AC_CHECK_LIB(ncurses, main, LIBS="$LIBS -lncurses", LIBS="$LIBS -lcurses")
++dnl Test if --enable-curses is given
++AC_ARG_ENABLE([curses],
++[AS_HELP_STRING([--enable-curses], [curses])])
++
++AS_IF([test "x$enable_curses" = "xyes"], [
++ PKG_CHECK_MODULES([NCURSES], [ncurses])
++])
+
+
+
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index b44632a..84e89b5 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -18,9 +18,7 @@ AM_CPPFLAGS = -I../h \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I../h -I${embprefix}/include \
+- -I${embprefix}/include/eplplot -I${embprefix}/include/epcre \
+- $(NLINCLUDES)
++AM_CPPFLAGS = -I$(top_srcdir)/h -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS) $(NCURSES_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -60,5 +58,5 @@ LDADD = ../ckit/libckit.la \
+ $(XLIB)
+ else
+ LDADD = ../ckit/libckit.la -L${embprefix}/lib -lnucleus -lacd -lajaxdb \
+- -lensembl -lajaxg -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lensembl -lajaxg -lajax $(NLADD) $(NCURSES_LIBS) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-mse/metadata.xml b/sci-biology/embassy-mse/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-mse/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-phylipnew/Manifest b/sci-biology/embassy-phylipnew/Manifest
new file mode 100644
index 000000000000..638f9da73ac0
--- /dev/null
+++ b/sci-biology/embassy-phylipnew/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-phylipnew-3.67.tar.gz 1624802 SHA256 efbfdbff0109c62823caf13f20cb6462f54371d55899fcbbe29240e503584945
+DIST embassy-phylipnew-3.69.650.tar.gz 1741298 SHA256 af385d01826e67e05295955f05721728abbd4feb9e11a944189414da6590bfeb SHA512 b41a31285e05a418e4fbfae7241c3658fe458e3d5d84bff472d98b7c145340a55bee1d744b5c056d0e88407074947b5f37b2182c9cb800c8a8d43dfa76d026d5 WHIRLPOOL 94cbe384a1575c322c7e3cdba7ccdb79e3e24cec7bd24776872f3e7d425d85c64fdcdc1cae6c079b40ca943b84a039ba2c7c5c059c40ceaf95c5c2e11e4a3e58
diff --git a/sci-biology/embassy-phylipnew/embassy-phylipnew-3.67.ebuild b/sci-biology/embassy-phylipnew/embassy-phylipnew-3.67.ebuild
new file mode 100644
index 000000000000..2bc4a956502f
--- /dev/null
+++ b/sci-biology/embassy-phylipnew/embassy-phylipnew-3.67.ebuild
@@ -0,0 +1,14 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS integrated version of PHYLIP - The Phylogeny Inference Package"
+LICENSE="freedist"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-phylipnew/embassy-phylipnew-3.69.650.ebuild b/sci-biology/embassy-phylipnew/embassy-phylipnew-3.69.650.ebuild
new file mode 100644
index 000000000000..18b8b33c91fb
--- /dev/null
+++ b/sci-biology/embassy-phylipnew/embassy-phylipnew-3.69.650.ebuild
@@ -0,0 +1,17 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="The Phylogeny Inference Package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+LICENSE+=" freedist"
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-phylipnew/files/embassy-phylipnew-3.69.650_fix-build-system.patch b/sci-biology/embassy-phylipnew/files/embassy-phylipnew-3.69.650_fix-build-system.patch
new file mode 100644
index 000000000000..1cba944094a2
--- /dev/null
+++ b/sci-biology/embassy-phylipnew/files/embassy-phylipnew-3.69.650_fix-build-system.patch
@@ -0,0 +1,111 @@
+ configure.ac | 49 +++++++------------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 7 ++-----
+ 3 files changed, 10 insertions(+), 48 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index e5bfaf1..09ed517 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -781,21 +754,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -918,6 +876,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 1883ce9..fb1787f 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -16,10 +16,7 @@ AM_CPPFLAGS = -I../include -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I../include -I${embprefix}/include \
+- -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I$(top_srcdir)/include -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -120,5 +117,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ ../../../plplot/libeplplot.la $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-phylipnew/metadata.xml b/sci-biology/embassy-phylipnew/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-phylipnew/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-signature/Manifest b/sci-biology/embassy-signature/Manifest
new file mode 100644
index 000000000000..8e615337acb6
--- /dev/null
+++ b/sci-biology/embassy-signature/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-signature-0.1.0.tar.gz 574940 SHA256 0966e165516448e214275e3cafcca91b9bb83d96264d2bf205aace1380138d2f
+DIST embassy-signature-0.1.650.tar.gz 622294 SHA256 2ab34cc76caaaefe7914e9b00dd12ee81a32d7a7ccca20ba901d67f1e2c2f27e SHA512 4989693b17c29ece16f94934e1b2f5e62f31c345bc8cbac938450db0d8f5d56ae37be6090c46e96725e63621c5951f8a65461cd36d4aafb1b509f3f554b4e952 WHIRLPOOL 1a943266ee9092f13fb3ad0779cdfe70e3cb5c1ed7d31164a93da90aaea2df95150970e0ef22df89c3cc97dfe7564092f2cab8aad7fb720e2f456cb363666de3
diff --git a/sci-biology/embassy-signature/embassy-signature-0.1.0-r3.ebuild b/sci-biology/embassy-signature/embassy-signature-0.1.0-r3.ebuild
new file mode 100644
index 000000000000..83f7f8487ee8
--- /dev/null
+++ b/sci-biology/embassy-signature/embassy-signature-0.1.0-r3.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Protein signature add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-signature/embassy-signature-0.1.650.ebuild b/sci-biology/embassy-signature/embassy-signature-0.1.650.ebuild
new file mode 100644
index 000000000000..b70e05d76087
--- /dev/null
+++ b/sci-biology/embassy-signature/embassy-signature-0.1.650.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Protein signature add-on package"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
+AUTOTOOLS_AUTORECONF=1
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
diff --git a/sci-biology/embassy-signature/files/embassy-signature-0.1.650_fix-build-system.patch b/sci-biology/embassy-signature/files/embassy-signature-0.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..32e4d684cbb3
--- /dev/null
+++ b/sci-biology/embassy-signature/files/embassy-signature-0.1.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 2f5ddd0..827543f 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index d77e43c..849f17a 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -68,5 +66,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-signature/metadata.xml b/sci-biology/embassy-signature/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-signature/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-structure/Manifest b/sci-biology/embassy-structure/Manifest
new file mode 100644
index 000000000000..7cd125ec2b29
--- /dev/null
+++ b/sci-biology/embassy-structure/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-structure-0.1.0.tar.gz 532035 SHA256 cd8b17947fe764e830bd14887deb85a5f196f490d25b9c6408aaca0c1baecd23
+DIST embassy-structure-0.1.650.tar.gz 588118 SHA256 06c3d07f495247d1427e91887fa00df053486e2b59f0ec722735bb0b957502f1 SHA512 56fb0ed975bfd95b1fbbccaf694e0617ec23971d53bdc230eeb6ca177907e784805697193e7630e4a513f1b4ee7a1a7974136520963557c452185be4ed22b641 WHIRLPOOL db988aab3f6d2165f44039385fd0a7ab2d6a7dce12906714d5932b411e3dfeac7e06a219af048ef120ea22acab3c1e958fefe68e6e1f19eec56de82c5c1b8c03
diff --git a/sci-biology/embassy-structure/embassy-structure-0.1.0-r3.ebuild b/sci-biology/embassy-structure/embassy-structure-0.1.0-r3.ebuild
new file mode 100644
index 000000000000..64b653083ff2
--- /dev/null
+++ b/sci-biology/embassy-structure/embassy-structure-0.1.0-r3.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="Protein structure add-on package for EMBOSS"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-structure/embassy-structure-0.1.650.ebuild b/sci-biology/embassy-structure/embassy-structure-0.1.650.ebuild
new file mode 100644
index 000000000000..b6fcd9770e3b
--- /dev/null
+++ b/sci-biology/embassy-structure/embassy-structure-0.1.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Protein structure add-on package"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-structure/files/embassy-structure-0.1.650_fix-build-system.patch b/sci-biology/embassy-structure/files/embassy-structure-0.1.650_fix-build-system.patch
new file mode 100644
index 000000000000..bdd9e37714e4
--- /dev/null
+++ b/sci-biology/embassy-structure/files/embassy-structure-0.1.650_fix-build-system.patch
@@ -0,0 +1,100 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 6 ++----
+ 2 files changed, 9 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index ee482ef..e4af4b1 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 81ade5d..2ed0d14 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -66,5 +64,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-structure/metadata.xml b/sci-biology/embassy-structure/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-structure/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-topo/Manifest b/sci-biology/embassy-topo/Manifest
new file mode 100644
index 000000000000..7da88ac0231b
--- /dev/null
+++ b/sci-biology/embassy-topo/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-topo-1.0.0.tar.gz 379929 SHA256 a7fd297c5e27becedd4aafd272123a176581c68b90de872fb3cb46356333cc16
+DIST embassy-topo-2.0.650.tar.gz 443510 SHA256 a8b8b7c1e04be44b5d6982614a9af44b84d0282bb917ed29e23a0a710241ad6f SHA512 8ef157a61ac47680734bed3d07cfe2bcd86730998453daa704b74aad667944ad6b0cc6f7fce36be4566cb19a626f1648d5f6793ce227cf57939fcfd0d10690a8 WHIRLPOOL fbe0edadeafe14b4b24be6fd65ed51dc9572f89e12e6f038017e9dd208a867138219350ccde6ca3eeab94ccedf34e5ec672a65cbf30c3819387407e778caeb55
diff --git a/sci-biology/embassy-topo/embassy-topo-1.0.0-r5.ebuild b/sci-biology/embassy-topo/embassy-topo-1.0.0-r5.ebuild
new file mode 100644
index 000000000000..f0ffdd356594
--- /dev/null
+++ b/sci-biology/embassy-topo/embassy-topo-1.0.0-r5.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS integrated version of TOPO - Transmembrane protein display"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-topo/embassy-topo-2.0.650.ebuild b/sci-biology/embassy-topo/embassy-topo-2.0.650.ebuild
new file mode 100644
index 000000000000..dec34b9db31f
--- /dev/null
+++ b/sci-biology/embassy-topo/embassy-topo-2.0.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Transmembrane protein display"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-topo/files/embassy-topo-2.0.650_fix-build-system.patch b/sci-biology/embassy-topo/files/embassy-topo-2.0.650_fix-build-system.patch
new file mode 100644
index 000000000000..3c37879de8c8
--- /dev/null
+++ b/sci-biology/embassy-topo/files/embassy-topo-2.0.650_fix-build-system.patch
@@ -0,0 +1,110 @@
+ configure.ac | 49 +++++++------------------------------------------
+ emboss_acd/Makefile.am | 2 +-
+ src/Makefile.am | 6 ++----
+ 3 files changed, 10 insertions(+), 47 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index 8eeb8ca..4fd28ac 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -635,33 +635,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -737,21 +710,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -874,6 +832,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/emboss_acd/Makefile.am b/emboss_acd/Makefile.am
+index e1c1878..e253c95 100644
+--- a/emboss_acd/Makefile.am
++++ b/emboss_acd/Makefile.am
+@@ -1,3 +1,3 @@
+
+-pkgdata_DATA = *.acd
++pkgdata_DATA = $(srcdir)/*.acd
+ pkgdatadir=$(prefix)/share/EMBOSS/acd
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 1cdb0b1..0e86a4b 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -17,9 +17,7 @@ AM_CPPFLAGS = -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -60,5 +58,5 @@ LDADD = ../../../nucleus/libnucleus.la ../../../ajax/acd/libacd.la \
+ $(XLIB)
+ else
+ LDADD = -L${embprefix}/lib -lnucleus -lacd -lajaxdb -lensembl -lajaxg \
+- -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-topo/metadata.xml b/sci-biology/embassy-topo/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-topo/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy-vienna/Manifest b/sci-biology/embassy-vienna/Manifest
new file mode 100644
index 000000000000..d7061f3dd813
--- /dev/null
+++ b/sci-biology/embassy-vienna/Manifest
@@ -0,0 +1,3 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST embassy-6.0.1-vienna-1.7.2.tar.gz 682200 SHA256 7bed50f9992aec250f974f5c5fd9a42d49c24f05e0e9fac88bb94b2d76be25db
+DIST embassy-vienna-1.7.2.650.tar.gz 873165 SHA256 d3c9f64394a5c59151a345c3a2d8e2b3fcab3b59918584776316c204f0bb6c6d SHA512 1484ca419ebcb7776d8f92dd633d4fda1a752a73ccb5189b58f7417a5611e015e9b42cbb37b51f4d5c7a27df0d5cab2cdf1e95ebd70a8359ffc8fa1633d28103 WHIRLPOOL 78679a7aca7db9b67774c9a07e11ecb081b0297c3e9c23e0f98d08ee96f62bef7b861ae223f2962ff79f67b0d9582168e21d869ae0ef6c9c23beb53102a351d2
diff --git a/sci-biology/embassy-vienna/embassy-vienna-1.7.2.650.ebuild b/sci-biology/embassy-vienna/embassy-vienna-1.7.2.650.ebuild
new file mode 100644
index 000000000000..62f1626a26a4
--- /dev/null
+++ b/sci-biology/embassy-vienna/embassy-vienna-1.7.2.650.ebuild
@@ -0,0 +1,15 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+EBO_DESCRIPTION="Vienna RNA package - RNA folding"
+
+AUTOTOOLS_AUTORECONF=1
+
+inherit emboss-r1
+
+KEYWORDS="~amd64 ~ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+
+PATCHES=( "${FILESDIR}"/${P}_fix-build-system.patch )
diff --git a/sci-biology/embassy-vienna/embassy-vienna-1.7.2.ebuild b/sci-biology/embassy-vienna/embassy-vienna-1.7.2.ebuild
new file mode 100644
index 000000000000..49eac3cdc4d8
--- /dev/null
+++ b/sci-biology/embassy-vienna/embassy-vienna-1.7.2.ebuild
@@ -0,0 +1,13 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EBOV="6.0.1"
+
+inherit embassy
+
+DESCRIPTION="EMBOSS integrated version of the Vienna RNA package - RNA folding"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/old/${EBOV}/EMBOSS-${EBOV}.tar.gz
+ mirror://gentoo/embassy-${EBOV}-${PN:8}-${PV}.tar.gz"
+
+KEYWORDS="amd64 ~ppc x86"
diff --git a/sci-biology/embassy-vienna/files/embassy-vienna-1.7.2.650_fix-build-system.patch b/sci-biology/embassy-vienna/files/embassy-vienna-1.7.2.650_fix-build-system.patch
new file mode 100644
index 000000000000..5ce365ed5497
--- /dev/null
+++ b/sci-biology/embassy-vienna/files/embassy-vienna-1.7.2.650_fix-build-system.patch
@@ -0,0 +1,108 @@
+ configure.ac | 49 +++++++------------------------------------------
+ src/Makefile.am | 7 +++----
+ 2 files changed, 10 insertions(+), 46 deletions(-)
+
+diff --git a/configure.ac b/configure.ac
+index f5a4ecf..bbe0743 100644
+--- a/configure.ac
++++ b/configure.ac
+@@ -649,33 +649,6 @@ AS_CASE([${host_os}],
+
+
+
+-dnl PCRE library definitions - see the MAJOR and MINOR values
+-dnl to see which version's configure.in these lines come from
+-
+-dnl Provide the current PCRE version information. Do not use numbers
+-dnl with leading zeros for the minor version, as they end up in a C
+-dnl macro, and may be treated as octal constants. Stick to single
+-dnl digits for minor numbers less than 10. There are unlikely to be
+-dnl that many releases anyway.
+-
+-PCRE_MAJOR="7"
+-PCRE_MINOR="9"
+-PCRE_DATE="11-Apr-2009"
+-PCRE_VERSION="${PCRE_MAJOR}.${PCRE_MINOR}"
+-
+-dnl Default values for miscellaneous macros
+-
+-POSIX_MALLOC_THRESHOLD="-DPOSIX_MALLOC_THRESHOLD=10"
+-
+-dnl Provide versioning information for libtool shared libraries that
+-dnl are built by default on Unix systems.
+-
+-PCRE_LIB_VERSION="0:1:0"
+-PCRE_POSIXLIB_VERSION="0:0:0"
+-
+-
+-
+-
+ dnl FIXME: This does no longer seem required with Autoconf 2.67?
+ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+ dnl AS_IF([test "x${with_x}" != "xno"],
+@@ -751,21 +724,6 @@ AX_LIB_POSTGRESQL
+
+
+
+-dnl "Export" these variables for PCRE
+-
+-AC_SUBST([HAVE_MEMMOVE])
+-AC_SUBST([HAVE_STRERROR])
+-AC_SUBST([PCRE_MAJOR])
+-AC_SUBST([PCRE_MINOR])
+-AC_SUBST([PCRE_DATE])
+-AC_SUBST([PCRE_VERSION])
+-AC_SUBST([PCRE_LIB_VERSION])
+-AC_SUBST([PCRE_POSIXLIB_VERSION])
+-AC_SUBST([POSIX_MALLOC_THRESHOLD])
+-
+-
+-
+-
+ dnl Test if --enable-localforce given
+ locallink="no"
+ embprefix="/usr/local"
+@@ -888,6 +846,13 @@ AC_ARG_ENABLE([systemlibs],
+ AM_CONDITIONAL([ESYSTEMLIBS], [test "x${enable_systemlibs}" = "xyes"])
+
+
++AS_IF([test "x${enable_systemlibs}" = "xyes"],
++[
++dnl using system libraries
++ PKG_CHECK_MODULES([PLPLOT], [plplotd],
++ [],[PKG_CHECK_MODULES([PLPLOT], [plplot])]
++ )
++])
+
+
+ # Enable the purify tool: --enable-purify, sets CC and LIBTOOL
+diff --git a/src/Makefile.am b/src/Makefile.am
+index 1f5b756..e178914 100644
+--- a/src/Makefile.am
++++ b/src/Makefile.am
+@@ -32,9 +32,7 @@ AM_CPPFLAGS = -I../H -I../../../nucleus -I../../../ajax/pcre \
+ -I../../../ajax/ensembl -I../../../ajax/ajaxdb \
+ -I../../../ajax/acd -I../../../plplot
+ else
+-AM_CPPFLAGS = -I../H -I${embprefix}/include -I${embprefix}/include/eplplot \
+- $(NLINCLUDES) \
+- -I${embprefix}/include/epcre
++AM_CPPFLAGS = -I$(top_srcdir)/H -I${embprefix}/include $(NLINCLUDES) $(PLPLOT_CFLAGS)
+ endif
+
+ if ISSHARED
+@@ -87,6 +85,7 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ liboviennarna_la_LDFLAGS = $(LINKFLAGS)
++liboviennarna_la_LIBADD = -lajax
+
+ ovrnaalifold_SOURCES = vrnaalifold.c
+ ovrnaalifoldpf_SOURCES = vrnaalifoldpf.c
+@@ -119,5 +118,5 @@ LDADD = liboviennarna.la \
+ $(XLIB)
+ else
+ LDADD = liboviennarna.la -L${embprefix}/lib -lnucleus -lacd -lajaxdb \
+- -lensembl -lajaxg -lajax -lepcre $(NLADD) -leplplot $(XLIB)
++ -lensembl -lajaxg -lajax $(NLADD) $(XLIB)
+ endif
diff --git a/sci-biology/embassy-vienna/metadata.xml b/sci-biology/embassy-vienna/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy-vienna/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/embassy/embassy-6.0.1.ebuild b/sci-biology/embassy/embassy-6.0.1.ebuild
new file mode 100644
index 000000000000..3c7c37b20ff6
--- /dev/null
+++ b/sci-biology/embassy/embassy-6.0.1.ebuild
@@ -0,0 +1,33 @@
+# Copyright 1999-2011 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+DESCRIPTION="A meta-package for installing all EMBASSY packages (EMBOSS add-ons)"
+HOMEPAGE="http://www.emboss.org/"
+SRC_URI=""
+LICENSE="GPL-2 freedist"
+
+SLOT="0"
+KEYWORDS="amd64 ~ppc x86"
+IUSE=""
+
+RDEPEND="!<sci-biology/emboss-6.0.1
+ !sci-biology/embassy-meme
+ !sci-biology/embassy-phylip
+ ~sci-biology/emboss-6.0.1
+ =sci-biology/embassy-cbstools-1.0.0
+ =sci-biology/embassy-domainatrix-0.1.0-r3
+ =sci-biology/embassy-domalign-0.1.0-r3
+ =sci-biology/embassy-domsearch-0.1.0-r3
+ =sci-biology/embassy-emnu-1.05-r5
+ =sci-biology/embassy-esim4-1.0.0-r5
+ =sci-biology/embassy-hmmer-2.3.2-r2
+ =sci-biology/embassy-iprscan-4.3.1
+ =sci-biology/embassy-memenew-0.1.0-r1
+ =sci-biology/embassy-mira-2.8.2
+ =sci-biology/embassy-mse-1.0.0-r6
+ =sci-biology/embassy-phylipnew-3.67
+ =sci-biology/embassy-signature-0.1.0-r3
+ =sci-biology/embassy-structure-0.1.0-r3
+ =sci-biology/embassy-topo-1.0.0-r5
+ =sci-biology/embassy-vienna-1.7.2"
diff --git a/sci-biology/embassy/embassy-6.6.0.ebuild b/sci-biology/embassy/embassy-6.6.0.ebuild
new file mode 100644
index 000000000000..d663e22efda3
--- /dev/null
+++ b/sci-biology/embassy/embassy-6.6.0.ebuild
@@ -0,0 +1,31 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+DESCRIPTION="A meta-package for installing all EMBASSY packages (EMBOSS add-ons)"
+HOMEPAGE="http://emboss.sourceforge.net/embassy/"
+
+LICENSE+=" freedist"
+SLOT="0"
+KEYWORDS="~amd64 ~x86 ~x86-linux ~ppc-macos"
+
+RDEPEND+="
+ >=sci-biology/embassy-cbstools-1.0.0.650
+ >=sci-biology/embassy-clustalomega-1.1.0
+ >=sci-biology/embassy-domainatrix-0.1.650
+ >=sci-biology/embassy-domalign-0.1.650
+ >=sci-biology/embassy-domsearch-0.1.650
+ >=sci-biology/embassy-emnu-1.05.650
+ >=sci-biology/embassy-esim4-1.0.0.650
+ >=sci-biology/embassy-hmmer-2.3.2.650
+ >=sci-biology/embassy-iprscan-4.3.1.650
+ >=sci-biology/embassy-meme-4.7.650
+ >=sci-biology/embassy-mse-3.0.0.650
+ >=sci-biology/embassy-phylipnew-3.69.650
+ >=sci-biology/embassy-signature-0.1.650
+ >=sci-biology/embassy-structure-0.1.650
+ >=sci-biology/embassy-topo-2.0.650
+ >=sci-biology/embassy-vienna-1.7.2.650
+"
diff --git a/sci-biology/embassy/metadata.xml b/sci-biology/embassy/metadata.xml
new file mode 100644
index 000000000000..f17a827e3101
--- /dev/null
+++ b/sci-biology/embassy/metadata.xml
@@ -0,0 +1,5 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+ <herd>sci-biology</herd>
+</pkgmetadata>
diff --git a/sci-biology/emboss/Manifest b/sci-biology/emboss/Manifest
new file mode 100644
index 000000000000..c364f2c77e86
--- /dev/null
+++ b/sci-biology/emboss/Manifest
@@ -0,0 +1,4 @@
+DIST EMBOSS-6.0.1.tar.gz 20204153 SHA256 3e352902aa9dab88bf486457ff23794f19398dfc6b550c4bf175dfcad34c233d
+DIST EMBOSS-6.3.1.tar.gz 23572243 SHA256 4f3290600a970c2a23a7e47f884d1fc8156ec40538f7191a6e83e23680d27a8d
+DIST EMBOSS-6.6.0.tar.gz 117962028 SHA256 7184a763d39ad96bb598bfd531628a34aa53e474db9e7cac4416c2a40ab10c6e SHA512 2d28a03381f7dc98d205aa50202fbbac02ad218fc775d86579d310296be124403623484b1907154d915f15cd32a9f8cf16ecfaa6c4a28b362e24dc8e6380b75a WHIRLPOOL 25241e865b1ad4e5459f84a2b0def7cd00a6e2904db714838dfe0533e01f8373cfdd4c78df225f9d2a77ead4cb9998791bd19f46b32e220810ad950fa288b9fe
+DIST emboss-6.3.1_p4.patch.gz 4070 SHA256 61d1b62e3148541d496103711db6526ba76488a0899af2c98264b03bf8d6e24c
diff --git a/sci-biology/emboss/emboss-6.0.1.ebuild b/sci-biology/emboss/emboss-6.0.1.ebuild
new file mode 100644
index 000000000000..0edfd7a639d0
--- /dev/null
+++ b/sci-biology/emboss/emboss-6.0.1.ebuild
@@ -0,0 +1,112 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=1
+
+inherit eutils
+
+DESCRIPTION="The European Molecular Biology Open Software Suite - A sequence analysis package"
+HOMEPAGE="http://emboss.sourceforge.net/"
+SRC_URI="ftp://${PN}.open-bio.org/pub/EMBOSS/old/${PV}/EMBOSS-${PV}.tar.gz"
+LICENSE="GPL-2 LGPL-2"
+
+SLOT="0"
+KEYWORDS="amd64 ppc x86"
+IUSE="X png minimal"
+
+DEPEND="
+ X? ( x11-libs/libXt )
+ png? (
+ sys-libs/zlib
+ media-libs/libpng
+ media-libs/gd
+ )
+ !minimal? (
+ sci-biology/primer3
+ sci-biology/clustalw
+ )"
+
+RDEPEND="${DEPEND}
+ !sys-devel/cons"
+
+PDEPEND="
+ !minimal? (
+ sci-biology/aaindex
+ sci-biology/cutg
+ sci-biology/prints
+ sci-biology/prosite
+ sci-biology/rebase
+ sci-biology/transfac
+ )"
+
+S="${WORKDIR}/EMBOSS-${PV}"
+
+src_unpack() {
+ unpack ${A}
+ cd "${S}"
+ epatch "${FILESDIR}"/${PN}-5.0.0-as-needed.patch
+
+ local link_string="$(pkg-config --libs x11)"
+ if use png; then
+ link_string="${link_string} -lgd $(pkg-config --libs libpng)"
+ fi
+ sed -e "s:PATCH_PLPLOT:${link_string}:" -i plplot/Makefile.in \
+ || die "Failed to patch ajax Makefile"
+}
+
+src_compile() {
+ local myconf
+ myconf="--includedir=${D}/usr/include/emboss"
+ use X || myconf="${EXTRA_CONF} --without-x"
+ use png || myconf="${EXTRA_CONF} --without-pngdriver"
+
+ econf ${myconf}
+ # Do not install the JEMBOSS component (the --without-java configure option
+ # does not work). JEMBOSS will eventually be available as a separate package.
+ sed -i -e "s/SUBDIRS = plplot ajax nucleus emboss test doc jemboss/SUBDIRS = plplot ajax nucleus emboss test doc/" \
+ Makefile || die
+ emake || die
+}
+
+src_install() {
+ einstall || die "Failed to install program files."
+
+ dodoc AUTHORS ChangeLog FAQ NEWS README THANKS \
+ || die "Failed to install documentation."
+ newdoc "${FILESDIR}"/${PN}-README.Gentoo-1 README.Gentoo \
+ || die "Failed to install Gentoo readme file."
+
+ # Install env file for setting libplplot and acd files path.
+ cat <<- EOF > 22emboss
+ # plplot libs dir
+ PLPLOT_LIB="/usr/share/EMBOSS/"
+ # ACD files location
+ EMBOSS_ACDROOT="/usr/share/EMBOSS/acd"
+ EOF
+ doenvd 22emboss || die "Failed to install environment file."
+
+ # Symlink preinstalled docs to "/usr/share/doc".
+ dosym /usr/share/EMBOSS/doc/manuals /usr/share/doc/${PF}/manuals || die
+ dosym /usr/share/EMBOSS/doc/programs /usr/share/doc/${PF}/programs || die
+ dosym /usr/share/EMBOSS/doc/tutorials /usr/share/doc/${PF}/tutorials || die
+ dosym /usr/share/EMBOSS/doc/html /usr/share/doc/${PF}/html || die
+
+ # Clashes #330507
+ mv "${D}"/usr/bin/{digest,pepdigest} || die
+
+ # Remove useless dummy files from the image.
+ find emboss/data -name dummyfile -delete || die "Failed to remove dummy files."
+
+ # Move the provided codon files to a different directory. This will avoid
+ # user confusion and file collisions on case-insensitive file systems (see
+ # bug #115446). This change is documented in "README.Gentoo".
+ mv "${D}"/usr/share/EMBOSS/data/CODONS{,.orig} || \
+ die "Failed to move CODON directory."
+
+ # Move the provided restriction enzyme prototypes file to a different name.
+ # This avoids file collisions with versions of rebase that install their
+ # own enzyme prototypes file (see bug #118832).
+ mv "${D}"/usr/share/EMBOSS/data/embossre.equ{,.orig} || \
+ die "Failed to move enzyme equivalence file."
+}
diff --git a/sci-biology/emboss/emboss-6.3.1_p4-r1.ebuild b/sci-biology/emboss/emboss-6.3.1_p4-r1.ebuild
new file mode 100644
index 000000000000..e8baba4c7752
--- /dev/null
+++ b/sci-biology/emboss/emboss-6.3.1_p4-r1.ebuild
@@ -0,0 +1,117 @@
+# Copyright 1999-2014 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI="4"
+
+inherit autotools eutils
+
+MY_PATCH="4"
+
+DESCRIPTION="The European Molecular Biology Open Software Suite - A sequence analysis package"
+HOMEPAGE="http://emboss.sourceforge.net/"
+SRC_URI="
+ ftp://${PN}.open-bio.org/pub/EMBOSS/old/${PV}/EMBOSS-${PV/_p${MY_PATCH}}.tar.gz
+ ftp://${PN}.open-bio.org/pub/EMBOSS/old/${PV}/fixes/patches/patch-1-${MY_PATCH}.gz -> ${P}.patch.gz"
+
+LICENSE="GPL-2 LGPL-2"
+SLOT="0"
+KEYWORDS="~amd64 ~ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+IUSE="doc minimal mysql pdf png postgres static-libs X"
+
+DEPEND="
+ dev-libs/expat
+ dev-libs/libpcre:3
+ sci-libs/plplot
+ sys-libs/zlib
+ mysql? ( virtual/mysql )
+ pdf? ( media-libs/libharu )
+ png? (
+ sys-libs/zlib
+ media-libs/libpng
+ media-libs/gd
+ )
+ postgres? ( dev-db/postgresql )
+ !minimal? (
+ sci-biology/primer3
+ sci-biology/clustalw
+ )
+ X? ( x11-libs/libXt )"
+RDEPEND="${DEPEND}
+ !sys-devel/cons"
+PDEPEND="
+ !minimal? (
+ sci-biology/aaindex
+ sci-biology/cutg
+ sci-biology/prints
+ sci-biology/prosite
+ sci-biology/rebase
+ sci-biology/transfac
+ )"
+
+S="${WORKDIR}/EMBOSS-${PV/_p${MY_PATCH}}"
+
+src_prepare() {
+ epatch "${WORKDIR}"/${P}.patch
+ epatch \
+ "${FILESDIR}"/${PV}-unbundle-libs.patch \
+ "${FILESDIR}/${PF}_plcol.patch"
+ eautoreconf
+}
+
+src_configure() {
+ econf \
+ $(use_with X x) \
+ $(use_with png pngdriver "${EPREFIX}/usr") \
+ $(use_with doc docroot "${EPREFIX}/usr") \
+ $(use_with pdf hpdf "${EPREFIX}/usr") \
+ $(use_with mysql mysql "${EPREFIX}/usr/bin/mysql_config") \
+ $(use_with postgres postgresql "${EPREFIX}/usr/bin/pg_config") \
+ $(use_enable amd64 64) \
+ $(use_enable static-libs static) \
+ --without-java \
+ --enable-large \
+ --enable-systemlibs \
+ --includedir="${ED}/usr/include/emboss"
+}
+
+src_install() {
+ einstall || die "Failed to install program files."
+
+ dodoc AUTHORS ChangeLog FAQ NEWS README THANKS
+ sed "s:EPREFIX:${EPREFIX}:g" "${FILESDIR}"/${PN}-README.Gentoo-2 > README.Gentoo && \
+ dodoc README.Gentoo
+
+ # Install env file for setting libplplot and acd files path.
+ cat <<- EOF > 22emboss
+ # plplot libs dir
+ PLPLOT_LIB="${EPREFIX}/usr/share/EMBOSS/"
+ # ACD files location
+ EMBOSS_ACDROOT="${EPREFIX}/usr/share/EMBOSS/acd"
+ EOF
+ doenvd 22emboss
+
+ # Symlink preinstalled docs to "/usr/share/doc".
+ dosym /usr/share/EMBOSS/doc/manuals /usr/share/doc/${PF}/manuals
+ dosym /usr/share/EMBOSS/doc/programs /usr/share/doc/${PF}/programs
+ dosym /usr/share/EMBOSS/doc/tutorials /usr/share/doc/${PF}/tutorials
+ dosym /usr/share/EMBOSS/doc/html /usr/share/doc/${PF}/html
+
+ # Clashes #330507
+ mv "${ED}"/usr/bin/{digest,pepdigest} || die
+
+ # Remove useless dummy files from the image.
+ find emboss/data -name dummyfile -delete || die "Failed to remove dummy files."
+
+ # Move the provided codon files to a different directory. This will avoid
+ # user confusion and file collisions on case-insensitive file systems (see
+ # bug #115446). This change is documented in "README.Gentoo".
+ mv "${ED}"/usr/share/EMBOSS/data/CODONS{,.orig} || \
+ die "Failed to move CODON directory."
+
+ # Move the provided restriction enzyme prototypes file to a different name.
+ # This avoids file collisions with versions of rebase that install their
+ # own enzyme prototypes file (see bug #118832).
+ mv "${ED}"/usr/share/EMBOSS/data/embossre.equ{,.orig} || \
+ die "Failed to move enzyme equivalence file."
+}
diff --git a/sci-biology/emboss/emboss-6.6.0.ebuild b/sci-biology/emboss/emboss-6.6.0.ebuild
new file mode 100644
index 000000000000..22d650f1107a
--- /dev/null
+++ b/sci-biology/emboss/emboss-6.6.0.ebuild
@@ -0,0 +1,61 @@
+# Copyright 1999-2015 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=5
+
+AUTOTOOLS_AUTORECONF=1
+inherit autotools-utils emboss-r1 eutils readme.gentoo
+
+DESCRIPTION="The European Molecular Biology Open Software Suite - A sequence analysis package"
+SRC_URI="ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-${PV}.tar.gz"
+
+KEYWORDS="~amd64 ppc ~x86 ~amd64-linux ~x86-linux ~ppc-macos"
+IUSE+=" minimal"
+LICENSE+=" Apache-2.0 GPL-3+ CC-BY-3.0"
+
+RDEPEND+=" !sys-devel/cons"
+PDEPEND+="
+ !minimal? (
+ sci-biology/aaindex
+ sci-biology/cutg
+ sci-biology/primer3
+ sci-biology/prints
+ sci-biology/prosite
+ sci-biology/rebase
+ )"
+
+S="${WORKDIR}"/EMBOSS-${PV}
+
+DOCS=( ChangeLog AUTHORS NEWS THANKS FAQ )
+
+PATCHES=(
+ "${FILESDIR}"/${P}_fix-build-system.patch
+ "${FILESDIR}"/${P}_FORTIFY_SOURCE-fix.patch
+ "${FILESDIR}"/${P}_plplot-declarations.patch
+ "${FILESDIR}"/${P}_qa-implicit-declarations.patch
+)
+
+src_install() {
+ # Use autotools-utils_* to remove useless *.la files
+ autotools-utils_src_install
+
+ readme.gentoo_create_doc
+
+ # Install env file for setting libplplot and acd files path.
+ cat > 22emboss <<- EOF
+ # ACD files location
+ EMBOSS_ACDROOT="${EPREFIX}/usr/share/EMBOSS/acd"
+ EMBOSS_DATA="${EPREFIX}/usr/share/EMBOSS/data"
+ EOF
+ doenvd 22emboss
+
+ # Remove useless dummy files
+ find "${ED}"/usr/share/EMBOSS -name dummyfile -delete || die "Failed to remove dummy files."
+
+ # Move the provided codon files to a different directory. This will avoid
+ # user confusion and file collisions on case-insensitive file systems (see
+ # bug #115446). This change is documented in "README.gentoo".
+ mv "${ED}"/usr/share/EMBOSS/data/CODONS{,.orig} || \
+ die "Failed to move CODON directory."
+}
diff --git a/sci-biology/emboss/files/22emboss b/sci-biology/emboss/files/22emboss
new file mode 100644
index 000000000000..177643ced11f
--- /dev/null
+++ b/sci-biology/emboss/files/22emboss
@@ -0,0 +1,4 @@
+# plplot libs dir
+PLPLOT_LIB="/usr/share/EMBOSS/"
+# ACD files location
+EMBOSS_ACDROOT="/usr/share/EMBOSS/acd"
diff --git a/sci-biology/emboss/files/6.3.1_p4-unbundle-libs.patch b/sci-biology/emboss/files/6.3.1_p4-unbundle-libs.patch
new file mode 100644
index 000000000000..5e463744a739
--- /dev/null
+++ b/sci-biology/emboss/files/6.3.1_p4-unbundle-libs.patch
@@ -0,0 +1,600 @@
+diff --git a/Makefile.am b/Makefile.am
+index 4fe2ed1..7f3a95f 100644
+--- a/Makefile.am
++++ b/Makefile.am
+@@ -5,12 +5,21 @@ ACLOCAL_AMFLAGS = -I m4
+
+ AUTOMAKE_OPTIONS = gnits
+
+-SUBDIRS = plplot ajax nucleus emboss test doc jemboss
++if !ESYSTEMLIBS
++EXTRA_DIRS = plplot
++endif
++
++if GJEMBOSS
++JEMBOSS_DIR = jemboss
++endif
++
++SUBDIRS = $(EXTRA_DIRS) ajax nucleus emboss test doc $(JEMBOSS_DIR)
++DIST_SUBDIRS = $(EXTRA_DIRS) ajax nucleus emboss test doc $(JEMBOSS_DIR)
+
+ # AJAX_FIXED_ROOT = \"`pwd`/emboss/acd\"
+
+ # files with nonstandard names in this directory
+-EXTRA_DIST = COMPAT LICENSE KNOWN_BUGS ONEWS PROBLEMS FAQ ChangeLog depcomp ltmain.sh
++EXTRA_DIST = COMPAT KNOWN_BUGS ONEWS PROBLEMS FAQ ChangeLog depcomp ltmain.sh
+
+ # tar to pick up the other directories
+ # then remove any CVS subdirectories
+diff --git a/README.fixes b/README.fixes
+new file mode 100644
+index 0000000..3c56d79
+--- /dev/null
++++ b/README.fixes
+@@ -0,0 +1,9 @@
++The files in this directory are bugfix replacements for files in
++the EMBOSS-6.3.1 distribution. Just drop the replacement files in
++the location shown and redo the 'make install.'
++
++Fix 1. EMBOSS-6.3.1/configure
++ EMBOSS-6.3.1/m4/mysql.m4
++
++21 Jul 2010: Addresses a problem whereby, in some circumstances, inclusion of
++ hpdf support prevented inclusion of MySQL support.
+diff --git a/ajax/Makefile.am b/ajax/Makefile.am
+index 4a44f6f..cf27ff8 100644
+--- a/ajax/Makefile.am
++++ b/ajax/Makefile.am
+@@ -1,6 +1,6 @@
+ ## Process this file with automake to produce Makefile.in
+ if !ESYSTEMLIBS
+-EXTRA_DIRS = expat zlib
++EXTRA_DIRS = pcre expat zlib
+ endif
+
+-SUBDIRS = pcre $(EXTRA_DIRS) core graphics ensembl ajaxdb acd
++SUBDIRS = $(EXTRA_DIRS) core graphics ensembl ajaxdb acd
+diff --git a/ajax/acd/Makefile.am b/ajax/acd/Makefile.am
+index 02bcaa7..368ddfe 100644
+--- a/ajax/acd/Makefile.am
++++ b/ajax/acd/Makefile.am
+@@ -13,10 +13,13 @@ CYGWIN_LDACD = -L../../plplot -L../pcre -L../expat -L../zlib -L../core \
+ endif
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
++else
++EXTRA_INCLUDES = $(PLPLOT_CFLAGS)
+ endif
+
+-INCLUDES = -I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre \
++INCLUDES = \
+ $(EXTRA_INCLUDES) \
+ -I$(top_srcdir)/ajax/core \
+ -I$(top_srcdir)/ajax/graphics \
+@@ -38,3 +41,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libacd_la_LDFLAGS = $(LINKFLAGS)
++libacd_la_LIBADD = ../core/libajax.la ../graphics/libajaxg.la ../ajaxdb/libajaxdb.la
+diff --git a/ajax/ajaxdb/Makefile.am b/ajax/ajaxdb/Makefile.am
+index da57727..857ca5f 100644
+--- a/ajax/ajaxdb/Makefile.am
++++ b/ajax/ajaxdb/Makefile.am
+@@ -13,11 +13,12 @@ CYGWIN_LDAJAXDB = -L../../plplot -L../pcre -L../expat -L../zlib -L../core \
+ endif
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
+ endif
+
+
+-INCLUDES = -I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre \
++INCLUDES = \
+ $(EXTRA_INCLUDES) \
+ -I$(top_srcdir)/ajax/core -I$(top_srcdir)/ajax/ensembl
+
+@@ -37,3 +38,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libajaxdb_la_LDFLAGS = $(LINKFLAGS)
++libajaxdb_la_LIBADD = ../core/libajax.la ../ensembl/libensembl.la
+diff --git a/ajax/core/Makefile.am b/ajax/core/Makefile.am
+index af27cb0..8fa4a3a 100644
+--- a/ajax/core/Makefile.am
++++ b/ajax/core/Makefile.am
+@@ -12,13 +12,18 @@ CYGWIN_LDAJAX = -L../../plplot -L../expat -L../pcre -L../zlib \
+ endif
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
++else
++EXTRA_LIBS = -lexpat -lpcre
+ endif
+
++EXTRA_DIST = ajax-pcre-config.h.in
++DISTCLEAN = ajax-pcre-config.h
+
+ INCLUDES = -DAJAX_FIXED_ROOT=$(AJAX_FIXED_ROOT) \
+ -DAJAX_SYSTEM="$(AJAX_SYSTEM)" -DPREFIX=\"$(prefix)\" \
+--I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre $(EXTRA_INCLUDES)
++$(EXTRA_INCLUDES) $(POSTGRESQL_CFLAGS) $(MYSQL_CFLAGS)
+
+ AJAXSRC = ajalign.c ajarr.c ajassert.c \
+ ajbase.c ajcall.c ajcod.c \
+@@ -44,7 +49,7 @@ ajindex.h ajjava.h ajlist.h \
+ ajmath.h ajmatrices.h ajmem.h ajmess.h \
+ ajnam.h ajnexus.h ajobo.h \
+ ajpat.h ajpdb.h ajpdbio.h ajphylo.h \
+-ajrange.h ajreg.h ajreport.h ajresource.h \
++ajrange.h ajreg.h ajax-pcre-config.h ajreport.h ajresource.h \
+ ajseq.h ajseqabi.h ajseqbam.h ajseqdata.h ajseqread.h ajseqtype.h ajseqwrite.h \
+ ajsort.h ajsql.h ajstr.h ajsys.h \
+ ajtable.h ajtax.h ajtime.h ajtranslate.h ajtree.h ajutil.h ajvector.h
+@@ -61,3 +66,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libajax_la_LDFLAGS = $(LINKFLAGS)
++libajax_la_LIBADD = $(EXTRA_LIBS) $(POSTGRESQL_LDFLAGS) $(MYSQL_LDFLAGS)
+diff --git a/ajax/core/ajax-pcre-config.h.in b/ajax/core/ajax-pcre-config.h.in
+new file mode 100644
+index 0000000..b09e4e6
+--- /dev/null
++++ b/ajax/core/ajax-pcre-config.h.in
+@@ -0,0 +1 @@
++@DEFINE_USE_SYSTEM_PCRE@ AJAX_USE_SYSTEM_PCRE
+diff --git a/ajax/core/ajreg.h b/ajax/core/ajreg.h
+index 06793be..659f462 100644
+--- a/ajax/core/ajreg.h
++++ b/ajax/core/ajreg.h
+@@ -16,9 +16,14 @@ extern "C"
+ #define ajreg_h
+
+ #include "ajax.h"
++#include "ajax-pcre-config.h"
++#ifndef AJAX_USE_SYSTEM_PCRE
+ #include "pcre_config.h"
+ #include "pcre_internal.h"
+ #include "pcreposix.h"
++#else
++#include <pcre.h>
++#endif
+
+ #define AJREG_OVECSIZE 30
+
+@@ -41,7 +46,11 @@ extern "C"
+ ******************************************************************************/
+
+ typedef struct AjSRegexp {
++#ifndef AJAX_USE_SYSTEM_PCRE
+ real_pcre *pcre;
++#else
++ pcre *pcre;
++#endif
+ pcre_extra *extra;
+ int *ovector;
+ const char* orig;
+diff --git a/ajax/ensembl/Makefile.am b/ajax/ensembl/Makefile.am
+index ca33a84..87e51bd 100644
+--- a/ajax/ensembl/Makefile.am
++++ b/ajax/ensembl/Makefile.am
+@@ -10,12 +10,13 @@ CYGWIN_LDENSEMBL = -L../../plplot -L../expat -L../pcre -L../core -lajax -leplplo
+ endif
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
+ endif
+
+
+-INCLUDES = -I$(top_srcdir)/plplot $(EXTRA_INCLUDES) \
+--I$(top_srcdir)/ajax/pcre -I$(top_srcdir)/ajax/core
++INCLUDES = $(EXTRA_INCLUDES) \
++-I$(top_srcdir)/ajax/core
+
+ ENSEMBLSRC = ensanalysis.c ensassembly.c ensassemblyexception.c \
+ ensassemblymapper.c ensattribute.c ensbaseadaptor.c enscache.c \
+@@ -56,3 +57,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libensembl_la_LDFLAGS = $(LINKFLAGS)
++libensembl_la_LIBADD = ../core/libajax.la
+diff --git a/ajax/graphics/Makefile.am b/ajax/graphics/Makefile.am
+index ab45afc..f61c605 100644
+--- a/ajax/graphics/Makefile.am
++++ b/ajax/graphics/Makefile.am
+@@ -10,11 +10,15 @@ CYGWIN_LDAJAXG = -L../../plplot -L../expat -L../pcre -L../core -lajax -leplplot
+ endif
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
++else
++EXTRA_INCLUDES = $(PLPLOT_CFLAGS) -DUSE_PLXSFNAM_SHIM
++EXTRA_LIBS = $(PLPLOT_LIBS)
+ endif
+
+
+-INCLUDES = -I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre \
++INCLUDES = \
+ $(EXTRA_INCLUDES) -I$(top_srcdir)/ajax/core
+
+ AJAXGSRC = ajgraph.c ajhist.c
+@@ -32,3 +36,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libajaxg_la_LDFLAGS = $(LINKFLAGS)
++libajaxg_la_LIBADD = ../core/libajax.la $(EXTRA_LIBS)
+diff --git a/ajax/graphics/ajgraph.c b/ajax/graphics/ajgraph.c
+index 25e75e4..60f2743 100644
+--- a/ajax/graphics/ajgraph.c
++++ b/ajax/graphics/ajgraph.c
+@@ -34,10 +34,8 @@
+ #include <float.h>
+ #define AZ 28
+
+-
+ #include "plplotP.h"
+
+-
+ static void GraphArray(ajuint numofpoints,
+ float *x, float *y);
+ static void GraphArrayGaps(ajuint numofpoints,
+@@ -1049,13 +1047,26 @@ static void GraphDefCharSize(float size)
+ ** @@
+ ******************************************************************************/
+
++#define _GNU_SOURCE
++#include <stdio.h>
++
+ static void GraphSetName(const AjPGraph thys,
+ const AjPStr txt, const char *ext)
+ {
+ if(!thys->ready)
+ {
++#ifdef USE_PLXSFNAM_SHIM
++ char *fullname;
++#endif
+ ajDebug("=g= plxsfnam ('%S', '%s')\n", txt, ext);
++#ifdef USE_PLXSFNAM_SHIM
++ fullname = asprintf(fullname,"%s%s", ajStrGetPtr(txt), ext);
++ ajDebug("=g= plsfnam ('%S') instead\n", fullname);
++ plsfnam(fullname);
++ free(fullname);
++#else
+ plxsfnam(ajStrGetPtr(txt), ext);
++#endif
+ ajStrAssignS(&graphBasename, txt);
+ ajStrAssignC(&graphExtension, ext);
+ if(ajStrGetCharFirst(graphExtension) == '.')
+diff --git a/configure.in b/configure.in
+index ddb4f81..3f4fe5e 100644
+--- a/configure.in
++++ b/configure.in
+@@ -235,15 +235,6 @@ AC_PROG_INSTALL
+ AC_PROG_LN_S
+ AC_PROG_MAKE_SET
+
+-dnl Intel MacOSX 10.6 puts X11 in a non-standard place
+-if test "${with_x}" != "no" ; then
+-if test "`uname -a | grep Darwin`"; then
+-OSXX=`sw_vers -productVersion | sed 's/\(10\.[[0-9]]*\).*/\1/'`
+-if test ${OSXX} '>' '10.4'; then
+-CFLAGS="$CFLAGS -I/usr/X11/include -L/usr/X11/lib"
+-fi
+-fi
+-fi
+
+ # Checks for header files.
+ #as# AC_PATH_X
+@@ -292,9 +283,6 @@ AC_CHECK_FUNCS(memmove)
+ #as# select socket sqrt strchr strcspn strdup strerror strpbrk \
+ #as# strrchr strspn strstr strtol])
+
+-if test "${with_x}" != "no" ; then
+-LF_EMBOSS_PATH_XLIB
+-fi
+
+ dnl Library checks
+ AC_CHECK_LIB(c, socket, LIBS="$LIBS" , LIBS="$LIBS -lsocket")
+@@ -316,14 +304,16 @@ CHECK_PNGDRIVER
+ CHECK_AUTH
+ CHECK_AMD64
+
++AM_CONDITIONAL(GJEMBOSS, test "$JAVA_OK" = "yes")
++
+ AX_LIB_MYSQL
+ AX_LIB_POSTGRESQL
+
+ CFLAGS="$CFLAGS $MYSQL_CFLAGS"
+ LDFLAGS="$LDFLAGS $MYSQL_LDFLAGS"
+
+-CFLAGS="$CFLAGS $POSTGRESQL_CFLAGS"
+-LDFLAGS="$LDFLAGS $POSTGRESQL_LDFLAGS"
++CFLAGS="$POSTGRESQL_CFLAGS $CFLAGS"
++LDFLAGS="$POSTGRESQL_LDFLAGS $LDFLAGS"
+
+
+ dnl Check for 'ant' for packaging Jemboss and export result
+@@ -443,13 +433,36 @@ fi
+
+ dnl Test if --enable-systemlibs given
+ have_systemlibs=no
++DEFINE_USE_SYSTEM_PCRE="#undef"
+ AC_ARG_ENABLE(systemlibs,
+ AS_HELP_STRING([--enable-systemlibs], [utility for RPM/dpkg bundles]))
++AC_MSG_CHECKING(for systemlib usage)
+ if test "${enable_systemlibs}" = "yes" ; then
+ have_systemlibs=yes
++ DEFINE_USE_SYSTEM_PCRE="#define"
++ PKG_CHECK_MODULES([PLPLOT], [plplotd])
++ PKG_CHECK_MODULES([ZLIB], [zlib])
++else
++ dnl X11 is only used by plplot
++ dnl Intel MacOSX 10.6 puts X11 in a non-standard place
++ if test "${with_x}" != "no" ; then
++ if test "`uname -a | grep Darwin`"; then
++ OSXX=`sw_vers -productVersion | sed 's/\(10\.[[0-9]]*\).*/\1/'`
++ if test ${OSXX} '>' '10.4'; then
++ CFLAGS="$CFLAGS -I/usr/X11/include -L/usr/X11/lib"
++ fi
++ fi
++ fi
++ if test "${with_x}" != "no" ; then
++ LF_EMBOSS_PATH_XLIB
++ fi
++ AC_MSG_NOTICE(USING bundled LIBS)
+ fi
+ AM_CONDITIONAL(ESYSTEMLIBS, test "$have_systemlibs" = "yes")
+ AC_SUBST(ESYSTEMLIBS)
++AC_SUBST(DEFINE_USE_SYSTEM_PCRE)
++AC_SUBST(PLPLOT_CFLAGS)
++AC_SUBST(PLPLOT_LIBS)
+
+
+
+@@ -457,7 +470,6 @@ AC_SUBST(ESYSTEMLIBS)
+
+ dnl Test if purify exists and if --enable-purify given if so
+ dnl set "-g"
+-
+ AC_MSG_CHECKING(for purify)
+ dnl if(purify -version) < /dev/null > /dev/null 2>&1; then
+ AC_ARG_ENABLE(purify,
+@@ -683,6 +695,7 @@ CHECK_THREADS
+
+
+ AC_OUTPUT([plplot/Makefile plplot/lib/Makefile nucleus/Makefile ajax/Makefile
++ajax/core/ajax-pcre-config.h
+ ajax/pcre/Makefile ajax/expat/Makefile ajax/zlib/Makefile ajax/core/Makefile
+ ajax/graphics/Makefile ajax/ensembl/Makefile ajax/ajaxdb/Makefile
+ ajax/acd/Makefile
+diff --git a/emboss/Makefile.am b/emboss/Makefile.am
+index 0820517..a0257b2 100644
+--- a/emboss/Makefile.am
++++ b/emboss/Makefile.am
+@@ -79,14 +79,17 @@ wordcount wordfinder wordmatch wossname \
+ yank
+
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
++else
++EXTRA_INCLUDES = $(PLPLOT_CFLAGS)
+ endif
+
+-INCLUDES = -I$(top_srcdir)/nucleus -I$(top_srcdir)/ajax/pcre \
++INCLUDES = -I$(top_srcdir)/nucleus \
+ $(EXTRA_INCLUDES) \
+ -I$(top_srcdir)/ajax/core -I$(top_srcdir)/ajax/graphics \
+ -I$(top_srcdir)/ajax/ensembl -I$(top_srcdir)/ajax/ajaxdb \
+- -I$(top_srcdir)/ajax/acd -I$(top_srcdir)/plplot
++ -I$(top_srcdir)/ajax/acd
+
+
+ aaindexextract_SOURCES = aaindexextract.c
+@@ -319,7 +322,7 @@ testplot_SOURCES = testplot.c
+ treetypedisplay_SOURCES = treetypedisplay.c
+
+ if !ESYSTEMLIBS
+-EXTRA_LDS = ../ajax/zlib/libezlib.la ../ajax/expat/libeexpat.la
++EXTRA_LDS = ../ajax/zlib/libezlib.la ../ajax/expat/libeexpat.la ../plplot/libeplplot.la ../ajax/pcre/libepcre.la
+ endif
+
+
+@@ -327,7 +330,6 @@ LDADD = ../nucleus/libnucleus.la ../ajax/acd/libacd.la \
+ ../ajax/ajaxdb/libajaxdb.la ../ajax/ensembl/libensembl.la \
+ ../ajax/graphics/libajaxg.la ../ajax/core/libajax.la \
+ $(EXTRA_LDS) \
+- ../ajax/pcre/libepcre.la ../plplot/libeplplot.la \
+ $(XLIB)
+
+ pkgdata_DATA = emboss.default.template
+diff --git a/m4/mysql.m4 b/m4/mysql.m4
+index fe413af..ebea25c 100644
+--- a/m4/mysql.m4
++++ b/m4/mysql.m4
+@@ -1,4 +1,6 @@
+-##### http://autoconf-archive.cryp.to/ax_lib_mysql.html
++# ===========================================================================
++# http://www.gnu.org/software/autoconf-archive/ax_lib_mysql.html
++# ===========================================================================
+ #
+ # SYNOPSIS
+ #
+@@ -6,19 +8,18 @@
+ #
+ # DESCRIPTION
+ #
+-# This macro provides tests of availability of MySQL client library
+-# of particular version or newer.
++# This macro provides tests of availability of MySQL client library of
++# particular version or newer.
+ #
+-# AX_LIB_MYSQL macro takes only one argument which is optional. If
+-# there is no required version passed, then macro does not run
+-# version test.
++# AX_LIB_MYSQL macro takes only one argument which is optional. If there
++# is no required version passed, then macro does not run version test.
+ #
+ # The --with-mysql option takes one of three possible values:
+ #
+ # no - do not check for MySQL client library
+ #
+-# yes - do check for MySQL library in standard locations
+-# (mysql_config should be in the PATH)
++# yes - do check for MySQL library in standard locations (mysql_config
++# should be in the PATH)
+ #
+ # path - complete path to mysql_config utility, use this option if
+ # mysql_config can't be found in the PATH
+@@ -33,27 +34,23 @@
+ #
+ # HAVE_MYSQL
+ #
+-# LAST MODIFICATION
++# LICENSE
+ #
+-# 2006-07-16
+-# 2007-01-09 MS: mysql_config --cflags may set gcc -fomit-frame-pointers,
+-# which prevents gdb from displaying stack traces.
+-# Changed mysql_config --cflags to mysql_config --include
++# Copyright (c) 2008 Mateusz Loskot <mateusz@loskot.net>
+ #
+-# COPYLEFT
+-#
+-# Copyright (c) 2006 Mateusz Loskot <mateusz@loskot.net>
+-#
+-# Copying and distribution of this file, with or without
+-# modification, are permitted in any medium without royalty provided
+-# the copyright notice and this notice are preserved.
++# Copying and distribution of this file, with or without modification, are
++# permitted in any medium without royalty provided the copyright notice
++# and this notice are preserved. This file is offered as-is, without any
++# warranty.
++
++#serial 12
+
+ AC_DEFUN([AX_LIB_MYSQL],
+ [
+ AC_ARG_WITH([mysql],
+- [AS_HELP_STRING([--with-mysql=@<:@ARG@:>@],
++ AS_HELP_STRING([--with-mysql=@<:@ARG@:>@],
+ [use MySQL client library @<:@default=yes@:>@, optionally specify path to mysql_config]
+- )],
++ ),
+ [
+ if test "$withval" = "no"; then
+ want_mysql="no"
+@@ -66,19 +63,20 @@ AC_DEFUN([AX_LIB_MYSQL],
+ ],
+ [want_mysql="yes"]
+ )
++ AC_ARG_VAR([MYSQL_CONFIG], [Full path to mysql_config program])
+
+ MYSQL_CFLAGS=""
+ MYSQL_LDFLAGS=""
+ MYSQL_VERSION=""
+
+ dnl
+- dnl Check MySQL libraries (libpq)
++ dnl Check MySQL libraries
+ dnl
+
+ if test "$want_mysql" = "yes"; then
+
+- if test -z "$MYSQL_CONFIG" -o test; then
+- AC_PATH_PROG([MYSQL_CONFIG], [mysql_config], [no])
++ if test -z "$MYSQL_CONFIG" ; then
++ AC_PATH_PROGS([MYSQL_CONFIG], [mysql_config mysql_config5], [no])
+ fi
+
+ if test "$MYSQL_CONFIG" != "no"; then
+@@ -90,35 +88,8 @@ dnl MYSQL_CFLAGS="`$MYSQL_CONFIG --cflags`"
+
+ MYSQL_VERSION=`$MYSQL_CONFIG --version`
+
+-dnl It isn't enough to just test for mysql_config as Fedora
+-dnl provides it in the mysql RPM even though mysql-devel may
+-dnl not be installed
+-
+- EMBCFLAGS=$CFLAGS
+- EMBLDFLAGS=$LDFLAGS
+- CFLAGS=$MYSQL_CFLAGS
+- LDFLAGS=$MYSQL_LDFLAGS
+-
+- AC_LINK_IFELSE([AC_LANG_PROGRAM([[#include <stdio.h>
+- #include "mysql.h"]],
+- [[mysql_info(NULL)]])],
+- [havemysql=yes],
+- [havemysql=no])
+-
+- CFLAGS=$EMBCFLAGS
+- LDFLAGS=$EMBLDFLAGS
+-
+- if test "$havemysql" = yes; then
+- AC_DEFINE([HAVE_MYSQL], [1],
+- [Define to 1 if MySQL libraries are available])
+- found_mysql="yes"
+- AC_MSG_RESULT([yes])
+- else
+- MYSQL_CFLAGS=""
+- MYSQL_LDFLAGS=""
+- found_mysql="no"
+- AC_MSG_RESULT([no])
+- fi
++ found_mysql="yes"
++ AC_MSG_RESULT([yes])
+ else
+ found_mysql="no"
+ AC_MSG_RESULT([no])
+@@ -170,6 +141,11 @@ dnl not be installed
+ fi
+ fi
+
++ if test "$found_mysql" = "yes" ; then
++ AC_DEFINE([HAVE_MYSQL], [1],
++ [Define to 1 if MySQL libraries are available])
++ fi
++
+ AC_SUBST([MYSQL_VERSION])
+ AC_SUBST([MYSQL_CFLAGS])
+ AC_SUBST([MYSQL_LDFLAGS])
+diff --git a/nucleus/Makefile.am b/nucleus/Makefile.am
+index c244786..ff301b9 100644
+--- a/nucleus/Makefile.am
++++ b/nucleus/Makefile.am
+@@ -19,13 +19,16 @@ CYGWIN_LIBS = -L../plplot -L../ajax/pcre -L../ajax/expat -L../ajax/zlib \
+ -lezlib -leplplot
+ else
+ if !ESYSTEMLIBS
+-EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib
++EXTRA_INCLUDES = -I$(top_srcdir)/ajax/expat -I$(top_srcdir)/ajax/zlib \
++-I$(top_srcdir)/plplot -I$(top_srcdir)/ajax/pcre
++else
++EXTRA_INCLUDES = $(PLPLOT_CFLAGS)
+ endif
+ endif
+
+
+-INCLUDES = -I$(top_srcdir)/plplot $(X_CFLAGS) -I$(srcdir)/ \
+- -I$(top_srcdir)/ajax -I$(top_srcdir)/ajax/pcre \
++INCLUDES = $(X_CFLAGS) -I$(srcdir)/ \
++ -I$(top_srcdir)/ajax \
+ $(EXTRA_INCLUDES) \
+ -I$(top_srcdir)/ajax/core -I$(top_srcdir)/ajax/graphics \
+ -I$(top_srcdir)/ajax/ensembl -I$(top_srcdir)/ajax/ajaxdb \
+@@ -55,3 +58,4 @@ LINKFLAGS = $(VERS_INF)
+ endif
+
+ libnucleus_la_LDFLAGS = $(LINKFLAGS)
++libnucleus_la_LIBADD = ../ajax/core/libajax.la ../ajax/graphics/libajaxg.la ../ajax/acd/libacd.la
diff --git a/sci-biology/emboss/files/README.Gentoo b/sci-biology/emboss/files/README.Gentoo
new file mode 100644
index 000000000000..ce37576f0fc4
--- /dev/null
+++ b/sci-biology/emboss/files/README.Gentoo
@@ -0,0 +1,28 @@
+Using EMBOSS on Gentoo systems
+
+Codon data files location
+
+The codon data files that are distributed with EMBOSS are installed in the
+"/usr/share/EMBOSS/data/CODONS.orig" director